Langzeitkontrolle von HIV durch CCR5 …

Langzeitkontrolle von HIV durch CCR5 …

Langzeitkontrolle von HIV durch CCR5 ...

Langzeitkontrolle von HIV durch CCR5 Delta32 / Delta32 Stammzelltransplantation

Artikel Tätigkeit

HIV-1 tritt in Wirtszellen durch an einen CD4-Rezeptor-Bindung und dann entweder mit CCR5 oder dem CXC-Chemokin-Rezeptor (CXCR4) interagieren. Homozygotie für eine 32-bp-Deletion (delta32 / delta32) in der CCR5 Allel Ergebnisse in einem inaktiven CCR5 Genprodukts und folglich verleiht hohe Resistenz gegen HIV-1-Akquisition. 1

Die allogene Stammzelltransplantation von einem HLA-passenden Spender ist eine mögliche Option für Patienten mit hämatologischen Neoplasien, aber es hat sich als therapeutische Option nicht für Patienten etabliert, die auch mit HIV infiziert. 2 Überleben von Patienten mit HIV-Infektion hat sich seit der Einführung der hochaktiven antiretroviralen Therapie (HAART), 3 und als Folge davon, erfolgreiche allogene Stammzelltransplantation mit laufenden HAART deutlich verbessert wurde im Jahr 2000 4 durchgeführt

In diesem Bericht beschreiben wir die Ergebnisse der allogenen Stammzelltransplantation bei einem Patienten mit einer HIV-Infektion und akute myeloische Leukämie, eine Transplantation von einem HLA-kompatiblen, nicht verwandten Spender unter Verwendung der für Homozygotie für das gezeigt wurde CCR5 delta32 Löschung.

Fallbericht

Ein 40-jähriger weißer Mann mit neu akuter myeloischer Leukämie (FAB M4-Subtyp, mit normalen zytogenetische Merkmale) diagnostiziert präsentiert in unsere Klinik. HIV-1-Infektion hatte früher mehr als 10 Jahren diagnostiziert wurde, und der Patient mit HAART (600 mg Efavirenz, 200 mg Emtricitabin und 300 mg Tenofovir pro Tag) behandelt worden waren, für die letzten 4 Jahre, während der keine Krankheiten in Verbindung mit dem erworbenen Immunschwächesyndrom (AIDS) wurden beobachtet. Zu der Zeit, dass die akute myeloische Leukämie diagnostiziert wurde, war der Patient CD4-T-Zellzahl 415 pro Kubikmillimeter, und HIV-1-RNA war nicht nachweisbar (Stufe A2 nach Klassifizierung von den Centers for Disease Control and Prevention). Die anfängliche Behandlung der akuten myeloischen Leukämie bestand aus zwei Kurse der Induktions-Chemotherapie und ein Konsolidierungskurs Chemotherapie. Während der ersten Induktions natürlich schwerer Leber toxischen Wirkungen entwickelt und Niereninsuffizienz. Folglich wurde HAART eingestellt, um einen viralen Rebound führenden (6,9 x 10 6 Kopien von HIV-1-RNA pro Milliliter). Die Therapie wurde sofort wieder aufgenommen, bevor ein viraler stationärer Zustand erreicht wurde, und 3 Monate später, HIV-1-RNA war nicht nachweisbar.

Sieben Monate nach der Präsentation, akute myeloische Leukämie rezidivierendem und der Patient unterzog sich einer allogenen Stammzelltransplantation mit CD34 + peripheren Blut-Stammzellen, die aus einem HLA-identischen Spender, der für die für homozygosity gescreent worden waren CCR5 delta32 Allel. Der Patient informierte Zustimmung für dieses Verfahren zur Verfügung gestellt, und das Protokoll wurde von der Institutional Review Board genehmigt. Die HLA-Genotypen des Patienten und Spender waren identisch zu den folgenden Loci: A * 0201; B * 0702,3501; Cw * 0401,0702; DRB1 * 0101,1501; und DQB1 * 0501,0602. Der Patient unterzog sich einer Konditionierung und erhielt ein Transplantat 2,3 × 10 6 CD34 + Zellen pro Kilogramm Körpergewicht enthält. 5 Prophylaxe gegen graft-versus-host disease bestand aus 0,5 mg Kaninchen Antithymozytenglobulin pro Kilogramm 3 Tage vor der Transplantation 2,5 mg pro Kilogramm 2 Tage vor und 2,5 mg pro Kilogramm 1 Tag vor. Der Patient erhielt zwei Dosen von 2,5 mg Cyclosporin pro kg intravenös 1 Tag vor der Behandlung und eine Behandlung mit Mycophenolat-Mofetil in einer Dosis von 1 g dreimal täglich 6 Stunden nach der Transplantation begonnen. HAART wurde bis zum Tag vor dem Eingriff verabreicht, und Verpflanzung wurde 13 Tage nach dem Eingriff erreicht. Mit Ausnahme der Anwesenheit von Klasse I Graft-versus-Host-Erkrankung der Haut, die durch Anpassung der Dosierung von Ciclosporin behandelt wurde, gab es keine schweren Infektionen oder toxische andere Effekte als Grad während ich im ersten Jahr der Follow-up. Akute myeloische Leukämie 332 Tage nach der Transplantation rezidivierendem und chimerism vorübergehend auf 15% gesenkt. Der Patient unterzog sich Reinduktion Therapie mit Cytarabin und Gemtuzumab und am Tag 391 empfangen ein zweites Transplantat, bestehend aus 2,1 × 10 6 CD34 + -Zellen pro Kilogramm, vom gleichen Spender, nach der Behandlung mit einer Einzeldosis von Ganzkörperbestrahlung (200 cGy). Das zweite Verfahren führte zu einer kompletten Remission der akuten myeloischen Leukämie, die sich noch im Monat 20 Follow-up in Remission war.

Methoden

CCR5 Genotypisierung

Genomische DNA wurde aus heparinisiertem peripheren Blut-Monozyten, die aus dem Patienten und dem potentiellen Spenders, mit der Verwendung des QIAamp Blut Midi Kit (Qiagen) extrahiert. Screening der Spender für die CCR5 delta32 Allel wurde mit einem genomischen Polymerase-Kettenreaktion (PCR) -Assay, mit Primern flankiert die Stelle der Deletion (vorwärts, 5’CTCCCAGGAATCATCTTTACC3 ‘; Reverse 5’TCATTTCGACACCGAAGCAG3’) durchgeführt wird, in einem PCR-Fragment von 200 bp für ergeb das CCR5 Allel und 168 bp für eine delta32 Löschung. Die Ergebnisse wurden durch allelspezifische PCR und direkte Sequenzierung mit der Verwendung des BigDye Terminator Cycle Sequencing Kit v1.1 (Applied Biosystems) bestätigt. Sequenzen wurden mit der Verwendung von Vector NTI ContigExpress Software (Invitrogen) analysiert.

Viral-Umschlag-Genotypisierung

Korezeptor Verwendung von HIV-1 wurde durch V3 Aminosäuresequenzen der bewerteten env Region für sowohl DNA als auch RNA. Bulk-PCR-Produkte wurden auf die direkte Sequenzierung unterworfen und bestimmt nach den 11/25 und Nettoladung Regeln, wie von Delobel et al. 6

Für die RNA, die HIV env Region wurde von Position 6538-6816 und Web positionsspezifischen Scoring-Matrix (WebPSSM) sequenziert und geno2pheno bioinformatischen Software verwendet wurde, virale Korezeptor Verwendung vorherzusagen. Darüber hinaus ist eine Ultradeep PCR-Analyse mit parallelen Sequenzierung (454-Life-Sciences, Roche) durchgeführt wurde. 7

Chemokinrezeptoren und Oberflächenantigene

Mukosalen Zellen wurden aus 10 rektale-Biopsien isoliert nach der Methode von Moos et al. 8 CCR5 Expression wurde durch Phytohämagglutinin (Sigma) stimuliert und die Zellen mittels mit der Verwendung von Antikörpern gegen CD3, CD4, CD11c, CD163 und CCR5 (BD Biosciences) fließen, analysiert der Zytometrie.

chimerism

Standard Chimärismus Analysen wurden auf die Unterscheidung zwischen Spender und Empfänger-Allele auf short tandem repeats basiert, mit der Verwendung von PCR und Fluoreszenz-markierten Primern gemäß dem Verfahren von Blau et al. 9

Zelluläre und humorale Immunantworten

Sekretion von Interferon-γ von antigen-spezifischen Zellen wurde gemäß dem Verfahren von Ganepola et al induziert. 10 Für die Messung der T-Zell-vermittelten Immunantworten, zwei HLA-A * 0201-Bindung wurden die Peptide verwendet: HIV-1476-484 (ILKEPVHGV) und Cytomegalovirus (CMV)65-73 (NLVPMVATV). Die Anwesenheit von Antikörpern gegen HIV-1 und HIV Typ-2 (HIV-2) wurde mittels eines Enzym-linked Immunoassay und Immunoblot-Assays in Übereinstimmung mit den Verfahren, die von den Herstellern (Abbott und Immogenetics) empfohlen bestimmt.

Amplifizierung von HIV-1 RNA und DNA

HIV-1-RNA wurde aus dem Plasma und amplifiziert mit der Verwendung des Cobas TaqMan AmpliPrep-HIV-Assay-System (Roche) isoliert. Gesamt-DNA wurde aus peripheren Blut-Monozyten und rektale-Biopsien mit der Verwendung des QIAamp DNA Blood Mini Kit und dem AllPrep DNA / RNA Mini Kit isoliert wurden (beide von Qiagen). das env und lang-terminal-repeat Regionen wurden nach der Methode von Cassol et al amplifiziert. und Drosten et al. 11,12 Die Empfindlichkeit des Assays betrug 40 RNA-Kopien pro Milliliter, und die untere Nachweisgrenze für beide komplementären DNA (cDNA) PCR-Assays 5 Kopien pro Reaktion, mit einer Positivität Rate von mehr als 95%. Jeder Assay enthielt 2 x 10 4 bis 5 x 10 4 CD4 + T-Zellen. Die erfolgreiche Amplifikation von 1 ug Zell-DNA aus verschiedenen Housekeeping-Gene extrahiert (GAPDH, CCR5, und CD4 ) 1 & mgr; g zellulärer DNA zeigte die Eignung der von den Schleimhautproben isolierten DNA extrahiert.

Ergebnisse

Aufteilung der CCR5-Allelen

Genomischer DNA aus 62 von 80 potentiellen HLA-identischen Stammzellspender registriert bei der Deutschen Knochenmarkspender wurde in der sequenziert CCR5 Region. Die Frequenzen des delta32-Allel und dem Wildtyp-Allel waren 0,21 und 0,79, respectively. Nur ein Spender war homozygot für die CCR5 delta32 Deletion in dieser Kohorte.

Analyse von HIV-1-Corezeptor Phenotype

Die Sequenzanalyse der viralen Varianten des Patienten zeigte ein Glycin an Position 11 und eine Glutaminsäure an Position 25 der V3-Region. Die Nettoladung von Aminosäuren war +3. Diese Ergebnisse zeigten, CCR5 Korezeptor Verwendung durch den HIV-1-Stamm, den Patienten zu infizieren, ein Befund, der durch Sequenzierung RNA in der HIV bestätigt wurde env Region. Die Ultradeep-Sequenzierung Analyse ergab einen Anteil von 2,9% für den X4 und Dual-tropischen kombinierten Varianten.

Empfänger Chimerism

Mit laufenden Verpflanzung, die PCR-Muster CCR5 wurden transformiert, eine Verschiebung von einem heterozygoten Genotyp zu einer homozygot delta32 / delta32 Genotyp (Abbildung 1 Abbildung 1 Genotyping von Anzeige CCR5 Allelen. ). Vollständige Chimärismus auf der Basis von Allel-short tandem repeats bestimmt, wurde 61 Tage nach allogener Stammzelltransplantation erhalten.

Zelluläre und humorale Immunantworten

T-Zell-Reaktionen auf bestimmte HLA-A2-restringierte Antigen, bestimmt mit der Verwendung eines Interferon-γ enzyme-linked immunospot Assay zeigten erhöhte Häufigkeiten von HIV-spezifischen T-Zellen vor Stammzelltransplantation und nicht nachweisbar Frequenzen nach der Transplantation (2A Figur 2 zellulären und humoralen Immunantwort auf HIV-1.). Immunoblot-Analyse zeigte einen überwiegenden Verlust der Antikörper nach der Transplantation Polymerase und Capsidproteine, wohingegen Konzentrationen von Antikörpern Glykoprotein 120 bis löslichen und Glykoprotein 41 detektierbar (2B) blieb.

Quantifizierung der Virämie

Die HIV-1-Last wurde mit der Verwendung von RNA und DNA-PCR-Assays gemessen (Abbildung 3 Abbildung 3 Klinischer Verlauf und HIV-1-Virämie.). Während des Follow-up-Periode, die Serumspiegel von HIV-1-RNA blieb nicht nachweisbar. Auch während des Follow-up, die semi-quantitativen Test zeigte keine nachweisbare provirale DNA außer am 20. Tag nach der Transplantation, sowohl für die env und lang-terminal-repeat-Loci und am 61. Tag nach der Transplantation, für die env Ort.

Rektal-Biopsien

In rektalen Biopsieproben 159 Tage nach der Transplantation erhalten, zeigte Makrophagen die Expression von CCR5, während eine deutliche CCR5 -Bevölkerung zum Ausdruck war in der Schleimhaut-CD4 + T-Lymphozyten (Abbildung 4 Abbildung 4: Expression von CD-Oberflächenantigen und Chemokine Korezeptor in der Rektumschleimhaut Patienten.) nicht vorhanden.

Diskussion

Um Zielzellen ein, HIV-1 erfordert sowohl CD4 und Korezeptor, überwiegend CCR5. Blockierung der bevorzugt verwendeten CCR5-Rezeptor durch Inhibitoren oder durch Gen Antiviren-Schutz bis R5-trop Varianten verliehenen Knockdown. 13,14 Die homozygot CCR5 delta32 Deletion, in etwa 1% der weißen Bevölkerung beobachtet, bietet eine natürliche Resistenz gegen HIV-Akquisition. Wir berichten über eine erfolgreiche Transplantation von allogenen Stammzellen homozygot für das CCR5 delta32 Allel zu einem Patienten mit HIV.

Obwohl Absetzen der antiretroviralen Therapie der Regel innerhalb weniger Wochen zu einer raschen Erholung der HIV-Belastung führt, bei diesem Patienten keine aktive, konnte die Replikation von HIV 20 Monate nachgewiesen werden nach HAART unterbrochen worden war. 15 Diese Beobachtung ist bemerkenswert, weil Homozygotie für CCR5 delta32 mit einer hohen, aber nicht vollständige Resistenz gegen HIV-1 assoziiert ist. Dieses Ergebnis kann durch das Verhalten der nicht-CCR5-tropen Varianten, wie CXCR4-tropen Viren (X4) erklärt werden, die in der Lage sind CXCR4 als Korezeptor verwenden. Die Umschaltung erfolgt in den natürlichen Verlauf der Infektion, und der Anteil der X4 steigt mit laufenden HAART. 16 genotypische und phänotypische Assays können verwendet werden, um die Art und das Ausmaß der Korezeptor Verwendung zu bestimmen, aber die Anwesenheit von heterogenen viralen Populationen in Proben von Patienten begrenzt die Empfindlichkeit des Assays. 17 Wenn genotypische Analyse in zwei Laboratorien durchgeführt wurde, die Anwendung WebPSSM und geno2pheno Prädiktionsalgorithmen, X4-Varianten wurden im Plasma von unseren Patienten nicht erkannt. Um den Anteil an kleineren Varianten im Plasma zu bestimmen, führten wir eine Ultradeep Sequenzierungsanalyse, die einen geringen Anteil an X4-Varianten vor der allogenen Stammzelltransplantation ergab.

Auch nach längerer HAART, die Persistenz des HIV-1-Populationen in verschiedenen anatomischen Kompartimente können in Patienten ohne nachweisbare Virämie beobachtet werden. 18 Insbesondere die intestinale lamina propria stellt ein wichtiges Reservoir von HIV-1, und genomische Virenerkennung möglich ist bei Patienten ohne Virämie. 19 Bei diesem Patienten eine rektale Biopsie durchgeführt 159 Tage nach der Transplantation zeigte, dass CCR5-exprimierenden vorliegenden Makrophagen waren noch in der Darmschleimhaut, die anzeigt, dass sie noch nicht durch das neue Immunsystem ersetzt. Obwohl diese langanhaltende Zellen aus dem Wirt viral Reservoire selbst nach der Transplantation, HIV-1-DNA nicht in dieses Patienten rektale Mukosa nachgewiesen werden konnte darstellen kann.

Es ist wahrscheinlich, dass X4 Varianten in anderen anatomischen Reservoire als potentielle Quellen für reemerging Viren geblieben, aber die Anzahl der X4-tropen infektiösen Partikel nach der Transplantation zu niedrig sein könnte gewesen Nachsaat des Patienten ersetzt Immunsystem zu ermöglichen.

Der Verlust der anti-HIV, virusspezifische, Interferon-γ-produzierenden T-Zellen während der Nachuntersuchung legt nahe, dass HIV-Antigen-Stimulation nach der Transplantation nicht vorhanden war. Dieses Verschwinden der Effektor-T-Zellen wurde nicht mit einer defizienten Immunrekonstitution verbunden sind, wie durch das Fehlen der entsprechenden Infektion oder Reaktivierung andere persistente Viren, wie CMV und Epstein-Barr-Virus gezeigt. Somit stellt die Abwesenheit von messbaren HIV Virämie in unseren Patienten wahrscheinlich die Entfernung des immunologischen Stimulus HIV. 20 Antikörper gegen HIV-Hüllantigene blieben nachweisbar, aber stetig sinkende Werte. Die anhaltende Sekretion von Antikörpern kann durch langlebige Plasmazellen verursacht werden, die relativ resistent gegenüber herkömmlichen immunsuppressiven Therapien sind. 21,22

In der Vergangenheit gab es mehrere Versuche, HIV-1-Infektion durch allogenen Stammzelltransplantation ohne Rücksicht auf den Spender zu steuern, CCR5 delta32 Status, aber diese Bemühungen waren nicht erfolgreich. 23 Bei unserem Patienten führte die Transplantation Chimärismus zu vervollständigen, und die Monozyten peripheren Blut des Patienten verändert von einem heterozygot homozygot Genotyp in Bezug auf die CCR5 delta32 Allel. Obwohl der Patient hatte nichtCCR5 -Tropic X4-Varianten und HAART wurde für mehr als 20 Monate, HIV-1-Virus im peripheren Blut, Knochenmark oder rektalen Schleimhaut festgestellt werden konnte nicht wie bei RNA und provirale DNA-PCR-Assays beurteilt eingestellt. Denn solange die Viruslast weiterhin antiretrovirale Therapie zu sein nicht mehr nachweisbar, wird dieser Patient nicht erforderlich. Unsere Ergebnisse unterstreichen die zentrale Rolle des CCR5-Rezeptor bei HIV-1-Infektion und Krankheitsprogression und sollte eine weitere Untersuchung der Entwicklung von Optionen CCR5-gezielte Behandlung zu fördern.

Unterstützt durch ein Stipendium der Deutschen Forschungsgemeinschaft (DFG KFO gewähren 104 1/1).

Dr. Hofmann-Berichte dienen als Berater oder Beratungs-Vorstandsmitglied und Sprecher «Büros für Celgene und Novartis. Kein anderer potenzieller Interessenkonflikt relevant zu diesem Artikel berichtet.

Drs. Hofmann und Thiel trugen gleichermaßen zu diesem Artikel.

Informationen zur Quelle

Referenzen

Liu R. Paxton WA. Choe S. et al. Homozygoten Defekt in HIV-1-Corezeptor entfallen Widerstand einiger Multiplikations-exponierten Individuen zu HIV-1-Infektion. Handy 1996; 86: 367-377
CrossRef | Web of Science | Medline

Ayash LJ. Ratanatharathorn V. Braun T. Silber SM. Reynolds CM. Uberti JP. Mit nicht verwandtem Spender Knochenmarktransplantation eine Chemotherapie nur präparative Regime für Erwachsene mit hohem Risiko akuter myeloischer Leukämie mit. Am J Hematol 2007; 82: 6-14
CrossRef | Web of Science | Medline

Palella FJ Jr. Delaney KM. Moorman AC. et al. Rückläufige Morbidität und Mortalität bei Patienten mit fortgeschrittenem humanen Immundefizienz-Virus-Infektion. N Engl J Med 1998; 338: 853-860
Kostenlose Volltext | Web of Science | Medline

Sora F. Antinori A. Piccirillo N. et al. Die hochaktive antiretrovirale Therapie und allogene CD34 (+) periphere Transplantation Blutvorläuferzellen in einer Koinfektion Patienten HIV / HCV mit akuter myeloischer Leukämie. Exp Hematol 2002; 30: 279-284
CrossRef | Web of Science | Medline

Schmid C. Weisser M. Ledderose G. Stotzer O. Schleuning M. Kolb HJ. Dosisreduzierten Konditionierung vor allogener Stammzelltransplantation: Grundsätze, klinische Protokolle und vorläufige Ergebnisse. Dtsch Med Wochenschr 2002; 127: 2186-2192
CrossRef | Web of Science | Medline

Delobel P. Nugeyre MT. Cazabat M. et al. Populationsbasierten Sequenzierung der V3-Region von env zur Vorhersage der Korezeptor Verwendung von humanen Immundefizienz-Virus Typ 1 Quasi-Spezies. J Clin Microbiol 2007; 45: 1572-1580
CrossRef | Web of Science | Medline

Moos V. D. Kunkel Marth T. et al. Reduzierte peripheren und Schleimhaut Tropheryma whipplei spezifische Th1-Antwort bei Patienten mit Morbus Whipple. J Immunol 2006; 177: 2015-2022
Web of Science | Medline

Blau IW. Schmidt-Hieber M. Leschinger N. et al. Verpflanzung Kinetik und hämatopoetischen Chimärismus nach reduzierten Konditionierung mit Fludarabin und Treosulfan vor allogener Stammzelltransplantation. Ann Hematol 2007; 86: 583-589
CrossRef | Web of Science | Medline

Ganepola S. Gentilini C. Hilbers U. et al. Patienten mit hohem Risiko für CMV-Infektion und Krankheit zeigen verzögerte CD8 + T-Zell-Immun Erholung nach allogener Stammzelltransplantation. Knochenmark-Transplantation 2007; 39: 293-299
CrossRef | Web of Science | Medline

Cassol S. Salas T. Arella M. Neumann P. Schechter MT. O’Shaughnessy M. Verwendung von getrockneten Blutfleck Proben bei der Erkennung von humanen Immundefizienz-Virus Typ 1 durch die Polymerase-Kettenreaktion. J Clin Microbiol 1991; 29: 667-671
Web of Science | Medline

Drosten C. Seifried E. Roth WK. TaqMan 5′-Nuklease Human Immunodeficiency Virus Typ 1-PCR-Assays mit dem Phagen-verpackt Wettbewerbs interne Kontrolle für die Hochdurchsatz-Screening-Blutspender. J Clin Microbiol 2001; 39: 4302-4308
CrossRef | Web of Science | Medline

Mueller MC. Bogner JR. Die Behandlung mit CCR5-Antagonisten: die Patient kann einen Nutzen haben? Eur J Med Res 2007; 12: 441-452
Web of Science | Medline

Anderson J. R. Akkina Vollständige Zuschlags von CCR5 von lentiviralen Vektor exprimierten siRNAs und Schutz transgener Makrophagen gegen HIV-1-Infektion. Gene Ther 2007; 14: 1287-1297
CrossRef | Web of Science | Medline

Jubault V. Burgard M. Le Corfec E. Costagliola D. Rouzioux C. Viard JP. Hoher Rebound von Plasma und zellulären HIV Belastung nach dem Absetzen der Dreifach-Kombinationstherapie. AIDS 1998; 12: 2358-2359
Web of Science | Medline

Delobel P. Sandres-Saune K. Cazabat M. et al. R5 zu X4 Schalter der vorherrschenden HIV-1-Population in zellulären Reservoirs während eines effektiven hochaktiven antiretroviralen Therapie. J Acquir Immune Defic Syndr 2005; 38: 382-392
CrossRef | Web of Science | Medline

Skrabal K. Low AJ. Dong W. et al. Die Bestimmung humanen Immundefizienz-Virus Korezeptor Verwendung in einer klinischen Umgebung: Grad der Korrelation zwischen zwei phänotypischen Assays und einem bioinformatischen Modell. J Clin Microbiol 2007; 45: 279-284
CrossRef | Web of Science | Medline

Delobel P. Sandres-Saune K. Cazabat M. et al. Persistenz von verschiedenen HIV-1-Populationen im Blut Monozyten und naiven und Gedächtnis-CD4-T-Zellen während der verlängerten suppressive HAART. AIDS 2005; 19: 1739-1750
CrossRef | Web of Science | Medline

Fackler OT. Schafer W. M. Schmidt et al. HIV-1 p24, aber nicht proviralen Last wird in der Darmschleimhaut erhöht verglichen mit dem peripheren Blut in HIV-infizierten Patienten. AIDS 1998; 12: 139-146
CrossRef | Web of Science | Medline

Kiepiela P. K. Ngumbela Thobakgale C. et al. CD8 + T-Zell-Reaktionen auf verschiedene HIV-Proteine ​​diskordanten Assoziationen mit Viruslast. Nat Med 2007; 13: 46-53
CrossRef | Web of Science | Medline

Wahren B. Gahrton G. Linde A. et al. Transfer und Persistenz von viralen Antikörper-produzierenden Zellen in der Knochenmarktransplantation. J Infect Dis 1984; 150: 358-365
CrossRef | Web of Science | Medline

Manz RA. Moser K. Burmester GR. Radbruch A. Hiepe F. Immunologische Gedächtnis Stabilisierung Autoreaktivität. Curr Top Microbiol Immunol 2006; 305: 241-257
CrossRef | Web of Science | Medline

Huzicka I. Könnte Marktransplantation Heilung AIDS Knochen? Med Hypotheses 1999; 52: 247-257
CrossRef | Web of Science | Medline

Unter Berufung auf die Artikel

George B. Kyei, William G. Powderly. Retroviren und Retrovirusinfektionen. 2017. 1483-1492.e1.
CrossRef

Rachel Presti, Giuseppe Pantaleo. Die Immunpathogenese von HIV-1-Infektion. 2017. 837-845.e3.
CrossRef

Stephen J. Kent. Eradikation und Heilung von HIV. 2017. 931-935.e1.
CrossRef

Keymanthri Moodley, Theresa Rossouw, Ciara Staunton, Christopher J. Colvin. (2016) Synergien, Spannungen und Herausforderungen in der HIV-Prävention, Behandlung und Heilung Forschung: Sondierungsgespräche mit HIV-Experten in Südafrika. BMC Medical Ethics17 : 1
CrossRef

Annals of Hematology95 : 9, 1435-1455
CrossRef

Linda Oseso, Amalia S. Magaret, Keith R. Jerome, Julie Fox, Anna Wald. (2016) Einstellungen und Risikobereitschaft für Experimentelle Therapie zu übernehmen Genital Herpes-Simplex-Virus-Infektion zu beseitigen. Sexuell übertragbare Krankheiten43 : 9, 566-571
CrossRef

Linya Sie, Lin Li, Jinfeng Zou, Kezhi Yan, Jad Belle, Anastasia Nijnik, Edwin Wang, Xiang-Jiao Yang. (2016) BRPF1 ist von wesentlicher Bedeutung für die Entwicklung des fetalen hämatopoetischen Stammzellen. Journal of Clinical Investigation126 : 9, 3247-3262
CrossRef

Hiromi Imamichi, Robin L. Dewar, Joseph W. Adelsberger, Catherine A. Rehm, Una O’Doherty, Ellen E. Paxinos, Anthony S. Fauci, H. Clifford Lane. (2016) Defekte HIV-1-Proviren produzieren neuartige Protein-kodierenden RNA-Spezies bei HIV-infizierten Patienten, die antiretrovirale Kombinationstherapie. Proceedings of the National Academy of Sciences113 : 31, 8783-8788
CrossRef

Kyung-Rok Yu, Hannah Natanson, Cynthia E. Dunbar. (2016) Gene Bearbeitung von humanen hämatopoetischen Stamm- und Progenitorzellen: Versprechen und Potenzial Hürden. Human Gene Therapy
CrossRef

Mark A. Lifson, Mehmet Ozgun Ozen, Fatih Inci, Shuqi Wang, Hakan Inan, Murat Baday, Timothy J. Henrich, Utkan Demirci. (2016) Fortschritte in der Biosensorik Strategien für die HIV-1-Erkennung, Diagnose und Therapiekontrolle. Advanced Drug Delivery Reviews103. 90-104
CrossRef

Olivier Pernet, Swati Seth Yadav, Dong Sung An. (2016) stammzellbasierten Therapien für HIV / AIDS. Advanced Drug Delivery Reviews103. 187-201
CrossRef

Manjunath N. Swamy, Haoquan Wu, Premlata Shankar. (2016) Jüngste Fortschritte in der RNAi-basierte Strategien für die Therapie und Prävention von HIV-1 / AIDS. Advanced Drug Delivery Reviews103. 174-186
CrossRef

Omar Süd, María Inés Figueroa, Pedro Cahn. (2016) Klinische Herausforderungen in der HIV / AIDS: Hinweise zur Entwicklung von Präventionsstrategien und Patientenmanagement voran. Advanced Drug Delivery Reviews103. 19.05
CrossRef

Shabnum Patel, R. Brad Jones, Douglas F. Nixon, Catherine M. Poller. (2016) T-Zell-Therapien für HIV: Präklinische Erfolge und aktuelle klinische Strategien. Zelltherapie18 : 8, 931-942
CrossRef

Christiana Smith, Elizabeth J. McFarland. (2016) Aktualisierung auf Pediatric Human Immunodeficiency Virus-Infektion. Die Fortschritte in der Pädiatrie63 : 1, 147-171
CrossRef

Sulggi A. Lee, Steven G. Deeks. (2016) die Vorteile des frühen antiretrovirale Therapie für HIV-Infektion: Wie früh früh genug. EBioMedicine
CrossRef

Johanna T. Crane, Theresa M. Rossouw. (2016) Inequality und Ethik in der pädiatrischen HIV Vergebung Forschung: Von Mississippi nach Südafrika und zurück. Global Public Health. 16.01
CrossRef

Christiana Smith, Elizabeth J. McFarland. (2016) verbleibenden Herausforderungen in Pediatric HIV-1-Infektion. Aktuelle Pediatrics Berichte
CrossRef

D. M. Margolis, J. V. Garcia, D. J. Hazuda, B. F. Haynes. (2016) Latenzumkehr und viralen Clearance zu heilen HIV-1. Wissenschaft353 : 6297, aaf6517-aaf6517
CrossRef

A. J. Murray, K. J. Kwon, D. L. Farber, R. F. Siliciano. (2016) Die Latent Reservoir für HIV-1: Wie immunologisches Gedächtnis und klonalen Expansion Beitrag zur HIV-1-Persistenz. The Journal of Immunology197 : 2, 407-417
CrossRef

Nature Medicine22 : 8, 839-850
CrossRef

Mariam Sophie, Abdul Hameed, Akhtar Munir, Azam J. Samdani, Saima Saleem, Abid Azhar. (2016) CC-Chemokin-Rezeptor 5 Δ32 Polymorphismus: Assoziationsanalyse und Allelverteilung unter kutanen Leishmaniose Patienten aus Pakistan. Journal of Pathology kutane43 : 7, 564-570
CrossRef

Nicolas Chomont, Matthieu Perreau. (2016) Strategien für Rest HIV-Infektion Targeting. Current Opinion in HIV und AIDS11 : 4, 359-361
CrossRef

Lydie Traut. (2016) zu töten. Current Opinion in HIV und AIDS11 : 4, 409-416
CrossRef

Chelsea Spragg, Harshana De Silva Feelixge, Keith R. Jerome. (2016) Cell und Gentherapiestrategien HIV-Reservoirs zu beseitigen. Current Opinion in HIV und AIDS11 : 4, 442-449
CrossRef

Tony Y. Hu. (2016) Kann Sugarcoated Fingerabdrücke verwendet werden lauern Viren zu identifizieren. PROTEOMICS16 : 13, 1947-1948
CrossRef

Steffen Leth, Mariane H Schleimann, Sara K Nissen, Jesper F Højen, Rikke Olesen, Mette E Graversen, Sofie Jørgensen, Anne Sofie Kjær, Paul W Denton, Alejandra Mørk, Maja A Sommerfelt, Kim Krogsgaard, Lars Østergaard, Thomas A Rasmussen, Martin Tolstrup, Ole Schmeltz Søgaard. (2016) kombinierte Wirkung von VACC-4x, rekombinanten humanen Granulozyten-Makrophagen-Kolonie-stimulierender Faktor Impfung und Romidepsin auf dem HIV-1-Reservoir (Reduc): einarmiger, Phase 1b / 2a-Studie. The Lancet HIV
CrossRef

Christopher W Pohlmeyer, Victoria E Walker-Sperling, Joel N Blankson. (2016) Was können wir das virale Reservoir in HIV-1-infizierten Personen zu reduzieren tun. Zukünftige Mikrobiologie11 : 7, 839-842
CrossRef

Christopher Thomas Scott, Laura DeFrancesco. (2016) Die Gentherapie Out-of-Body-Erfahrung. Nature Biotechnology34 : 6, 600-607
CrossRef

Rahul Palchaudhuri, Borja Saez, Jonathan Hoggatt, Amir Schajnovitz, David B Sykes, Tiffany A Tate, Agnieszka Czechowicz, Youmna Kfoury, FNU Ruchika, Derrick J Rossi, Gregory L Verdine, Michael K Mansour, David T Scadden. (2016) nichtgentoxischen Konditionierung für hämatopoetische Stammzelltransplantation eine hämatopoetische-zellspezifische Internalisierung Immunotoxin verwenden. Nature Biotechnology34 : 7, 738-745
CrossRef

Arun Nalla, Grant Trobridge. (2016) Die Aussichten für Schäumendes viraler Vektor Anti-HIV-Gentherapie. biomedizinische Arzneimittel4. 8
CrossRef

Yan-Mei Huang, Xue-Zhi Hong, Jia-Hua Xu, Jiang-Xi Luo Han-You Mo, Hai-Lu Zhao. (2016) Autoimmunität und Stoffwechselstörungen des menschlichen Immunschwäche-Syndrom erworben. Immunologische Forschung64 : 3, 641-652
CrossRef

Himanshu Garg, Raphael T. C. Lee, Sebastian Maurer-Stroh, Anjali Joshi. (2016) HIV-1 Anpassung an geringe Mengen an CCR5 Ergebnisse in V3 und V2-Schleife Änderungen, die Hülle Pathogenität erhöhen, Affinität CCR5 und verringern die Anfälligkeit für Maraviroc. Virologie493. 86-99
CrossRef

Janine Scholefield, Marc S. Weinberg. (2016) Die Anwendung von CRISPR / Cas9 Technologien und Therapien in Stammzellen. Aktuelle Stem Cell Reports2 : 2, 95-103
CrossRef

Anthony R Cillo, John W Mellors. (2016) Welche therapeutische Strategie wird ein Heilmittel für HIV-1 zu erzielen. Current Opinion in Virology18. 14-19
CrossRef

M. D. Hoban, D. E. Bauer. (2016) Ein Genom Bearbeitung Primer für die Hämatologe. Blut127 : 21, 2525-2535
CrossRef

C. X. Wang, P. M. Kanone. (2016) Die klinische Anwendung der Genom Bearbeitung in HIV. Blut127 : 21, 2546-2552
CrossRef

Albert M Anderson, Raymond F Schinazi, William R Tyor. (2016) HIV-Latenz Umkehr Forschung und die möglichen Auswirkungen auf das zentrale Nervensystem: die Sorge, gerechtfertigt ist. Journal der International AIDS Society19 : 1
CrossRef

Moran Benhar, Iart Luca Shytaj, Jonathan S. Stamler, Andrea Savarino. (2016) Dual-Targeting der Thioredoxin und Glutathion-Systeme bei Krebs und HIV. Journal of Clinical Investigation126 : 5, 1630-1639
CrossRef

Himanshu Garg, Anjali Joshi. (2016) Bedingtes zytotoxischen Anti-HIV-Gen-Therapie für Wählbare Zellmodifikation. Human Gene Therapy27. 400-415
CrossRef

Brodie Miles, Elizabeth Connick. (2016) TFH in der HIV-Latenz und als Quellen der Replikations-kompetente Virus. Trends in der Mikrobiologie24. 338-344
CrossRef

Kirston Barton, Anni Winckelmann, Sarah Palmer. (2016) HIV-1-Reservoire Während Suppressionstherapie. Trends in der Mikrobiologie24. 345-355
CrossRef

Immunogenetik68. 327-337
CrossRef

Mark A. Wainberg, Ying-Shan Han, Thibault Mesplède. (2016) Dolutegravir könnte Teil einer funktionellen Heilung für HIV sein? 1. Canadian Journal of Microbiology62 : 5, 375-382
CrossRef

Alcides Troncoso. (2016) Wird es ein Heilmittel für HIV / AIDS sein? Vom Traum zur Realität. Asian Pacific Journal of Tropical Biomedicine6 : 5, 441-442
CrossRef

R Simmons, M Kall, S Collins, G Cairns, S Taylor, M Nelson, S Fidler, K Porter, J. Fox. (2016) Eine weltweite Umfrage von HIV-positiven Menschen die Haltung gegenüber Heilung Forschung. HIV Medicine
CrossRef

Francesca Spanevello, Arianna Calistri, Claudia Del Vecchio, Barbara Mantelli, Chiara Frasson, Giuseppe Basso, Giorgio Palù, Marina Cavazzana, Cristina Parolin. (2016) Entwicklung von lentiviralen Vektoren Ausdruck gleichzeitig mehrere siRNAs gegen CCR5, vif und tat / rev-Gene für eine HIV-1-Ansatz der Gentherapie. Molecular Therapy-Nucleic Acids5. E312
CrossRef

Michelle Kim, Robert F Siliciano. (2016) Genome Bearbeitung für klinische HIV-Isolate. Nature Biotechnology34. 388-389
CrossRef

Keymanthri Moodley, Ciara Staunton, Malcolm de Roubaix, Mark Cotton. (2016) Forschung HIV-Behandlung in Südafrika: eine Vorerkundung von Stakeholder-Perspektiven. AIDS Pflege28. 524-527
CrossRef

Xiaolin Guo, Sijia Er, Xiaoyi Lv, Haibo Ding, Sha Li, Jing Kang, Jing Liu, Chaolong Qin, Wenqing Geng, Yongjun Jiang, Hong Shang. (2016) Die Rolle von HIV-1 in Affecting die Proliferationsfähigkeit von HPCs Von BM abgeleitet. JAIDS Journal of Acquired Immune Deficiency Syndromes71. 467-473
CrossRef

Aryn A. Price, Arash Grakoui, David S. Weiss. (2016), um die Prokaryotic Adaptive Immunsystem als eukaryotische Antivirale Defense nutzbar zu machen. Trends in der Mikrobiologie24. 294-306
CrossRef

Vagheesh M. Narasimhan, Yali Xue, Chris Tyler-Smith. (2016) Menschen Knockout Carriers: Tote, Erkrankte, gesund, oder verbessert werden. Trends in Molecular Medicine22. 341-351
CrossRef

Philip J. Goulder, Sharon R. Lewin, Ellen M. Leitman. (2016) Pädiatrische HIV-Infektion: das Potenzial für die Heilung. Nature Reviews Immunology16. 259-271
CrossRef

Steven J. Howe, Michael D. Milsom. (2016) Barrieren für eine erfolgreiche Genome Editing von hämatopoetischen Stammzellen. Aktuelle Stem Cell Reports2. 2-8
CrossRef

Shabnum Patel, Sharon Lam, Conrad Russell Cruz, Kaylor Wright, Christina Cochran, Richard F. Ambinder, Catherine M. Poller. (2016) Funktionell aktive HIV-spezifische T-Zellen, die Ziel Gag und Nef Kann von Virus-Naïve Spender erweitert werden und eine Reihe von Viral-Epitopen Ziel: Implikationen für eine Heilung Strategie nach allogener hämatopoetischer Stammzelltransplantation. Biologie von Blut und Knochenmarktransplantation22 : 3, 536-541
CrossRef

Christopher W. Peterson, Kevin G. Haworth, Bryan P. Burke, Patricia Polacino, Krystin K. Norman, Jennifer E. Adair, Shiu-Lok Hu, Jeffrey S. Bartlett, Geoff P. Symonds, Hans-Peter Kiem. (2016) multilineage polyklonalen Verpflanzung von Cal-1-Gen-veränderten Zellen und in vivo-Selektion nach SHIV-Infektion in einem nicht-menschlichen Primatenmodell von AIDS. Molecular Therapy — Methoden & Klinische Entwicklung3. 16007
CrossRef

Kevin G. Buell, Christopher Chung, Zain Chaudhry, Aiysha Puri, Khizr Nawab, Rahul Prashanth Ravindran. (2016) für lebenslanges antiretrovirale Therapie oder HIV-Behandlung: Die Vorteile für den einzelnen Patienten. AIDS Pflege28. 242-246
CrossRef

Ich Hosseini, F Mac Gabhann. (2016) mechanistische Modelle Predict Wirksamkeit von CCR5-defizienten Stammzellen-Transplantationen bei HIV-Patienten-Populationen. CPT: Pharmacometrics & Systeme Pharmakologie5 : 10.1002 / psp4.v5.2, 82-90
CrossRef

Marcella Flores, Rowena Johnston. (2016) Curing HIV: Moving Forward Schneller. AIDS-Forschung und Human Retroviruses32. 125-128
CrossRef

Frank Maldarelli. (2016) Die Rolle der HIV-Integration in Viruspersistenz: nicht mehr pfeifend vorbei am proviral Friedhof. Journal of Clinical Investigation126. 438-447
CrossRef

Janet D. Siliciano, Robert F. Siliciano. (2016) Die jüngsten Entwicklungen bei den Bemühungen der HIV-Infektion zu heilen: über N gehen = 1. Journal of Clinical Investigation126. 409-414
CrossRef

Katherine Luzuriaga. (2016) Frühe Kombination antiretrovirale Therapie Begrenzt HIV-1-Persistenz bei Kindern. Annual Review of Medicine67 : 1, 201-213
CrossRef

Alyssa R. Martin, Robert F. Siliciano. (2016) Fortschritte bei der HIV-Eradikation: Fallberichte, die laufenden Bemühungen, die Herausforderungen im Zusammenhang mit Heilung. Annual Review of Medicine67 : 1, 215-228
CrossRef

Marcella Flores, Rowena Johnston. (2016) Die Aushärtung HIV — Moving Forward Schneller. AIDS-Forschung und Human Retroviruses
CrossRef

Matthew Porteus. (2016) Genome Schnitt: Ein neuer Ansatz für Humantherapeutika. Jahresbericht für Pharmakologie und Toxikologie56 : 1, 163-190
CrossRef

Daniel R. Kuritzkes. (2016) hämatopoetische Stammzelltransplantation bei HIV-Behandlung. Journal of Clinical Investigation126. 432-437
CrossRef

Daniele C. Cary, Koh Fujinaga, B. Matija Peterlin. (2016) Molekulare Mechanismen der Latenz von HIV. Journal of Clinical Investigation126. 448-454
CrossRef

R. Brad Jones, Bruce D. Walker. (2016) HIV-spezifische CD8 + T-Zellen und HIV-Eradikation. Journal of Clinical Investigation126. 455-463
CrossRef

Sayuri Seki, Tetsuro Matano. (2016) Entwicklung eines Sendai-Virus-Vektor-basierte AIDS-Impfstoff induziert T-Zell-Antworten. Expert Review of Vaccines15. 119-127
CrossRef

Christine Johnston, Robert Harrington, Rupali Jain, Joshua Schiffer, Hans-Peter Kiem, Ann Woolfrey. (2016) Sicherheit und Wirksamkeit der Kombinationstherapie in Antiretroviral Human Immunodeficiency Virus-infizierten Erwachsenen Durchmachen autologer oder allogener hämatopoetischer Zelltransplantation für malignen hämatologischen Erkrankungen. Biologie von Blut und Knochenmarktransplantation22. 149-156
CrossRef

Jeremy Sugarman, Sharon R Lewin, Timothy J Henrich, Thomas A Rasmussen. (2016) Ethik der ART Unterbrechung nach Stammzelltransplantation. The Lancet HIV3. e8-e10
CrossRef

K. I. Papadopoulos, P. Wattanaarsakit, W. Prasongchean, R. Narain. Gentherapien in klinischen Studien. 2016. 231-256.
CrossRef

Adam M. Spivak, Vicente Planelles. (2016) HIV-1-Eradikation: Frühe Studien (und Drangsal). Trends in Molecular Medicine22. 10-27
CrossRef

Amrita Krishnan, Joseph Alvarnas, John J. Rossi, John A. Zaia. Hämatopoetische Zelltherapie für Human Immunodeficiency Virus-Infektion. 2016. 781-793.
CrossRef

Jennifer E. Adair, Grant D. Trobridge, Hans-Peter Kiem. Genetische Manipulation von hämatopoetischen Stammzellen. 2016. 78-99.
CrossRef

Anver Kuliev, O. Verlinsky, S. Rechitsky. Erbkrankheit Spezifische humanen embryonalen Stammzelllinien. 2016. 259-263.
CrossRef

Bruce D. Walker. AIDS-Impfstoffe. 2016. 401-422.
CrossRef

M. Freissmuth. Antivirale Pharmaka. 2016. 729-760.
CrossRef

Mary Collins, Adrian Thrasher. (2015) Gentherapie: Fortschritte und Prognosen. Proceedings of the Royal Society B: Biological Sciences282. 20143003
CrossRef

HyunJun Kang, Petra Minder, Mi Ae Park, Walatta-Tseyon Mesquitta, Bruce E Torbett, Igor I Slukvin. (2015) CCR5 Disruption in induzierten pluripotenten Stammzellen CRISPR / Cas9 eine selektive Resistenz von Immunzellen zu CCR5-trop HIV-1-Virus. Molecular Therapy-Nucleic Acids4. E268
CrossRef

Anh Q. Le, Jeremy Taylor, Winnie Dong, Rosmarin McCloskey, Conan Woods, Ryan Danroth, Kanna Hayashi, M.-J. Milloy, Kunst F. Y. Poon, Zabrina L. Brumme. (2015) Differenz Entwicklung eines CXCR4-unter Verwendung von HIV-1-Stamm in CCR5wt / wt und CCR5Δ32 / Δ32 Wirte durch Längstiefe Sequenzierung und phylogenetische Rekonstruktion enthüllt. Wissenschaftliche Berichte5. 17607
CrossRef

Stuart Rennie, Mark Siedner, Joseph D Tucker, Keymanthri Moodley. (2015) Die Ethik des Sprechens über «HIV heilen». BMC Medical Ethics16
CrossRef

Krissanapong Manotham, Supreecha Chattong, Anant Setpakdee. (2015) Erzeugung von CCR5-defekten Zellen aus CD34 ZFN-driven Stopcodon integrierten mesenchymale Stammzellklone. Journal of Biomedical Wissenschaft22
CrossRef

Maggie L Bobbin, John C Burnett, John J Rossi. (2015) RNA interference Ansätze zur Behandlung von HIV-1-Infektion. Genom Medizin7
CrossRef

Sohrab Z. Khan, Nicholas Hand, Steven L. Zeichner. (2015) Apoptosis-induzierte Aktivierung von HIV-1 in latent infizierten Zellinien. Retrovirology12
CrossRef

Chao Liu, Xiancai Ma, Bingfeng Liu, Cancan Chen, Hui Zhang. (2015) HIV-1 funktionelle Heilung: kommt der Traum wahr. BMC Medicine13
CrossRef

P M Younan, P Polacino, J P Kowalski, S-L Hu, H-P-Kiem. (2015) Combinatorial hämatopoetischen Stammzelltransplantation und Impfung reduziert virale Pathogenese folgende SHIV89.6P-Herausforderung. Gentherapie22. 1007-1012
CrossRef

Aurélie Cleret-Buhot, Yuwei Zhang, Delphine Planas, Jean-Philippe Goulet, Patricia Monteiro, Annie Gosselin, Vanessa Sue Wacleche, Cécile L. Tremblay, Mohammad-Ali Jenabian, Jean-Pierre Routy, Mohamed El-Far, Nicolas Chomont, Elias K. Haddad, Rafick-Pierre Sekaly, Petronela Ancuta. (2015) Identifizierung neuer HIV-1 Abhängigkeitsfaktoren in primären CCR4 + CCR6 + Th17-Zellen über eine genomweite Transkriptions Ansatz. Retrovirology12
CrossRef

Matthew H. Porteus. (2015) Auf dem Weg zu einer neuen Ära in der Medizin: therapeutische Genom Bearbeitung. Genome Biology16
CrossRef

Brigitte Autran. (2015) zu einer Heilung der HIV-Sucht wirksamen therapeutischen Impfstoff-Strategien. European Journal of Immunology45 : 10.1002 / eji.2015.45.issue-12, 3215-3221
CrossRef

Deepanwita Bose, Jean Gagnon, Yahia Chebloune. (2015) Vergleichende Analyse von Tat-abhängige und Tat-defizienten Natur Lentiviren. Veterinärwissenschaften2. 293-348
CrossRef

Antoinette G. Nelson, Xiaoping Zhang, Usha Ganapathi, Zoltan Szekely, Charles W. Flexner, Andrew Owen, Patrick J. Sinko. (2015) Drug-Delivery-Strategien und Systeme für die HIV / AIDS-Vorbelichtung Prophylaxe und Behandlung. Journal of Controlled Release219. 669-680
CrossRef

Laurentia C. Setiawan, Neeltje A. Kootstra. (2015) Adaptation von HIV-1 zu rhTrim5α vermittelte Restriktions in vitro. Virologie486. 239-247
CrossRef

Daniel Amsterdam. (2015) Immuntherapeutische Ansätze zur Kontrolle und Ausrottung von HIV. Immunologische Untersuchungen44. 719-730
CrossRef

Gene M. Shearer, Mario Clerici, David R. Graham, Adriano Boasso. (2015) Die Aushärtung HIV / AIDS über hämatopoetischen Stammzelltransplantation. AIDS29. 2364-2366
CrossRef

R Dey, B Pillai. (2015) Cell basierten Gentherapie gegen HIV. Gentherapie22. 851-855
CrossRef

Bundesgesundheits — Gesundheitsforschung — Gesundheitsschutz58. 1351-1370
CrossRef

Janet M. Siliciano, Robert F. Siliciano. (2015) Die bemerkenswerte Stabilität des Latent Reservoir für HIV-1 in Ruhe Gedächtnis CD4 + T-Zellen. Journal of Infectious Diseases212 : 9, 1345-1347
CrossRef

Panpan Hou, Shuliang Chen, Shilei Wang, Xiao Yu, Yu Chen, Meng Jiang, Ke Zhuang, Wenzhe Ho, Wei Hou, Jian Huang, Deyin Guo. (2015) Genome Bearbeitung von CXCR4 durch CRISPR / cas9 verleiht resistenten Zellen zur HIV-1-Infektion. Wissenschaftliche Berichte5. 15577
CrossRef

Carl H. Juni Bruce L. Levine. (2015) T-Zell-Engineering als Therapie gegen Krebs und HIV: unsere synthetische Zukunft. Philosophical Transactions der Royal Society B: Biological Sciences370. 20140374
CrossRef

Mark A. Brockman, R. Brad Jones, Zabrina L. Brumme. (2015) Herausforderungen und Chancen für die T-Zellvermittelte Strategien zur Beseitigung von HIV Stauseen. Frontiers in Immunology6
CrossRef

Young-Il Jo, Hyongbum Kim, Suresh Ramakrishna. (2015) Die jüngsten Entwicklungen und klinische Studien unter Verwendung von gentechnisch Zinkfingernukleasen Technologie. Cellular and Molecular Life Sciences72. 3819-3830
CrossRef

Steven G. Deeks, Julie Overbaugh, Andrew Phillips, Susan Buchbinders. (2015) HIV-Infektion. Nature Reviews Krankheit Grundierungen. 15035
CrossRef

Jintanat Ananworanich, Francoise Barré-Sinoussi. (2015) Ist es Zeit, einzelne Intervention Heilung Versuche zu verzichten. The Lancet HIV2. e410-E411
CrossRef

Kristina Allers, Thomas Schneider. (2015) CCR5Δ32 Mutation und HIV-Infektion: Grundlage für die kurative HIV-Therapie. Current Opinion in Virology14. 24-29
CrossRef

Telle L. Ahlenstiel, Kazuo Suzuki, Katherine Marks, Geoff P. Symonds, Anthony D. Kelleher. (2015) Controlling HIV-1: Non-coding RNA Gentherapieansätze zu einer funktionellen Heilung. Frontiers in Immunology6
CrossRef

Zachary Clarke Rich Chuncheng Liu, Qingyan Ma, Fengyu Hu, Weiping Cai, Xiaoping Tang, Joseph David Tucker. (2015) Arzt Wahrnehmung von HIV-Behandlung in China: Eine gemischte Methoden Überprüfung und Implikationen für HIV Heilung Forschung. Asian Pacific Journal of Tropical Disease5. 687-690
CrossRef

Mark N. Polizzotto Grace Chen, Randall L. Tressler, Catherine Godfrey. (2015) Nutzung Cancer Therapeutics für die HIV Cure Agenda: Aktueller Status und Perspektiven. Drogen75. 1447-1459
CrossRef

Daniel I. S. Rosenbloom, Oliver Elliott, Alison L. Hill, Timothy J. Henrich, Janet M. Siliciano, Robert F. Siliciano. (2015) Konzeption und Interpretation Grenzverdünnung Assays: allgemeine Prinzipien und Anwendungen auf das latente Reservoir für HIV-1. Open Forum Infectious Diseases. ofv123
CrossRef

Kathrin Schumann, Steven Lin, Eric Boyer, Dimitre R. Simeonov, Meena Subramaniam, Rachel E. Tor, Genevieve E. Haliburton, Chun J. Ye, Jeffrey A. Bluestone, Jennifer A. Doudna, Alexander Marson. (2015) Erzeugung von Knock-in primären humanen T-Zellen Cas9 Ribonukleoproteine ​​verwenden. Proceedings of the National Academy of Sciences112. 10.437-10.442
CrossRef

David H. McDermott, Ji-Liang Gao, Philip M. Murphy. (2015) Chromothriptic Heilung von WHIM Syndrom: Auswirkungen auf die Knochenmarktransplantation. Seltene Krankheiten. 00-00
CrossRef

Ulrike Jung, Kevin Urak, Maxime Veillette, Marie-Édith Nepveu-Traversy, Quang Toan Pham, Sophie Hamel, John J. Rossi, Lionel Berthoux. (2015) präklinische Bewertung der mutante humane TRIM5α als Anti-HIV-1 Transgene. Human Gene Therapy. 150806140242000
CrossRef

Marshall E Karpel, Christian L Boutwells, Todd M Allen. (2015) BLT humanisierte Mäuse als ein kleines Tiermodell der HIV-Infektion. Current Opinion in Virology13. 75-80
CrossRef

George E. Griffin, Yalan Liu Chang Li, Wei Jin, Robin J. Shattock, Ping Wang, Biao Wu, Xinmeng Guan, Bodan Hu Tao Du, Qinxue Hu. (2015) Inhibition of HIV-1-Infektion von primären CD4 + T-Zellen, die durch Gen-Bearbeitung von CCR5 mittels Adenovirus-gelieferten CRISPR / Cas9. Journal of General Virology96. 2381-2393
CrossRef

Viren7. 4186-4203
CrossRef

Hye Ji Oh, Dongjin Choi, Chul Juni Goh, Yoonsoo Hahn. (2015) Der Verlust der Genfunktion und Entwicklung der menschlichen Phänotypen. BMB Berichte48. 373-379
CrossRef

Adeolu Oyemade Adegoke, Michael David Grant. (2015) Enhancing Human Immunodeficiency Virus-spezifischen CD8 + T-Zellantworten mit heteroklitischen Peptides. Frontiers in Immunology6
CrossRef

Ying-Ru Lo, Carissa Chu, Jintanat Ananworanich, Jean-Louis Excler, Joseph D. Tucker. (2015) Stakeholder Engagement bei HIV Cure Research: Lessons Learned aus anderen HIV-Maßnahmen und den Weg nach vorne. AIDS Patient Care und sexuell übertragbare Krankheiten29. 389-399
CrossRef

Rachel S Leibman, James L Riley. (2015) Technik T-Zellen zu Funktionell Cure HIV-1-Infektion. Molecular Therapy23. 1149-1159
CrossRef

Jade Ghosn, Konstanz Delaugerre. (2015) Können wir eine Unterbrechung der Behandlung Studien bei der Suche nach einer HIV-Behandlung zu vermeiden. AIDS29. 1575-1577
CrossRef

Elena Herrera-Carrillo, Ben Berkhout. (2015) Bone Marrow Gentherapie für HIV / AIDS. Viren7. 3910-3936
CrossRef

Peter Piot, Salim S Abdool Karim, Robert Hecht, Helena Legido-Quigley, Kent Buse, John Stover, Stephen Resch, Theresa Ryckman, Sigrun Møgedal, Mark Dybul, Eric Goosby, Charlotte Watts, Nduku Kilonzo, Joanne McManus, Michel Sidibé. (2015) Defeating AIDS-vorrückenden globale Gesundheit. Die Lanzette386 : 9989, 171-218
CrossRef

U. Mock, R. Machowicz, I. Hauber, S. Horn, P. Abramowski, B. Berdien, J. Hauber, B. Fehse. (2015) mRNA-Transfektion eines neuartigen TAL-Effektor-Nuclease (TALEN) ermöglicht die effiziente Knockout von HIV-Korezeptor CCR5. Nucleic Acids Research43. 5560-5571
CrossRef

Sheena Saayman, Stuart A Ali, Kevin V Morris, Marc S Weinberg. (2015) Die therapeutische Anwendung von CRISPR / Cas9 Technologien für HIV. Gutachten über die biologische Therapie15. 819-830
CrossRef

Bruce Levine, Rachel Leskowitz, Megan Davis. (2015) Personalisierte Gentherapie sperrt HIV aus, ebnet den Weg Virus zu kontrollieren, ohne antiretrovirale Medikamente. Gutachten über die biologische Therapie15. 831-843
CrossRef

Priyamvada Acharya, Sabrina Lusvarghi, Carole A Bewley, Peter D Kwong. (2015) HIV-1 gp120 als therapeutisches Ziel: eine Bewegungs Labyrinth navigieren. Expert Opinion on Therapeutic Targets19. 765-783
CrossRef

Maria M. Bednar, Christa Buck Sturdevant, Lauren A. Tompkins, Kathryn Twigg Arrildt, Elena Dukhovlinova, Laura P. Kincer, Ronald Swanstrom. (2015) Kompartimentierung, Viral Evolution und Viral Latenz von HIV im ZNS. Aktuelle HIV / AIDS-Berichte12. 262-271
CrossRef

Carolina Garrido, David M. Margolis. (2015) Translational Herausforderungen bei der Ausrichtung der latenten HIV-Infektion und das ZNS Reservoir Problem. Journal of NeuroVirology21. 222-226
CrossRef

Avindra Nath. (2015) zur Ausrottung der menschlichen Immunschwäche-Virus aus dem Gehirn Stauseen. Journal of NeuroVirology21. 227-234
CrossRef

BJ Brew, K. Robertson, EJ Wright, M. Chill, SM Crowe, LA Cysique, S. Deeks, JV Garcia, B. Gelman, LR Grau, T. Johnson, J. Joseph, DM Margolis, JL Mankowski, B. Spencer. (2015) Symposium HIV-Eradikation: das Gehirn zurückgelassen werden. Journal of NeuroVirology21. 322-334
CrossRef

Jay A. Levy. (2015) Mythen Zerstreuung und die Konzentration auf bemerkenswerte Konzepte in der HIV-Pathogenese. Trends in Molecular Medicine21. 341-353
CrossRef

Christopher W. Peterson, Kevin G. Haworth, Patricia Polacino, Meei-Li Huang, Craig Sykes, Willimark M. Obenza, Andrea C. Repetto, Angela Kashuba, Roger Bumgarner, Stephen C. DeRosa, Ann E. Woolfrey, Keith R. Jerome, James I. Mullins, Shiu-Lok Hu, Hans-Peter Kiem. (2015) Der Mangel an Viruskontrolle und Entwicklung von antiretroviralen Kombinationstherapie Mutationen bei Makaken nach Knochenmarktransplantation. AIDS. 1
CrossRef

Jun Xiao Jiang Deng, Liping Lv, Qiong Kang, Ping Ma, Fan Yan Xin Song Bo Gao, Yanyu Zhang, Jinbo Xu. (2015) Wasserstoffperoxid Induce Menschen Cytomegalovirus-Replikation durch die Aktivierung von p38-MAPK Signalweg. Viren7. 2816-2833
CrossRef

Timothy J Henrich. (2015) HIV-Eradikation: ist Nabelschnurblut die Antwort. The Lancet HIV2. E219-E220
CrossRef

Rafael F Duarte, María Salgado, Isabel Sánchez-Ortega, Montserrat Arnan, Carmen Canals, Eva Domingo-Domenech, Alberto Fernández-de-Sevilla, Eva González-Barca, Sara Morón-López, Nuria Nogues, Beatriz Patiño, Maria Carmen Puertas, Bonaventura Clotet, Lawrence D Petz, Sergio Querol, Javier Martinez-Picado. (2015) CCR5 Δ32 homozygot Nabelschnurblut allogene Transplantation bei einem Patienten mit HIV: a case report. The Lancet HIV2. E236-E242
CrossRef

Nathan W. Cummins, Andrew D. Badley. (2015) Kann HIV geheilt werden und sollten wir versuchen. Mayo Clinic Proceedings90 : 6, 705-709
CrossRef

Wen Shi Lee, Matthew Sidney Parsons, Stephen John Kent, Marit Lichtfuss. (2015) Kann HIV-1-spezifische ADCC Assist die Clearance von Reaktivierte latent infizierten Zellen. Frontiers in Immunology6
CrossRef

Tae-Wook Chun, Susan Moir, Anthony Fauci. (2015) HIV-Reservoirs als Hindernisse und Chancen für eine HIV-Behandlung. Nature Immunology16. 584-589
CrossRef

Joseph C. Alvarnas. Hämatopoetischen Zelltransplantation bei HIV-Lymphome. 2015 217-232.
CrossRef

Daniele Focosi, Fabrizio Maggi, Luca Ceccherini-Nelli, Mauro Pistello. (2015) Cell Therapien für die Behandlung des humanen Immundefizienz-Virus-Infektion. Reviews in Medical Virology25 : 10.1002 / rmv.v25.3, 156-174
CrossRef

AIDS29. 867-876
CrossRef

Patrick M Younan, Christopher W Peterson, Patricia Polacino, John P Kowalski, Willimark Obenza, Hannah W Miller, Brian P Milless, Phil Gafken, Stephen C DeRosa, Shiu-Lok Hu, Hans-Peter Kiem. (2015) Lentivirus-vermittelte Gentransfer in hämatopoetische Stammzellen beeinträchtigt in SHIV-infizierten, ART-behandelten nicht-menschlichen Primaten. Molecular Therapy23. 943-951
CrossRef

Qingsheng Li, Yue Tso, Guobin Kang, Wuxun Lu, Yue Li, Wenjin Fan, Zhe Yuan, Christopher J Destache, Charles Wood. (2015) Am frühen Beginn der antiretroviralen Therapie können funktionell steuern produktive HIV-1-Infektion bei humanisierten-BLT-Mäusen. JAIDS Journal of Acquired Immune Deficiency Syndromes. 1
CrossRef

Matthew D. Marsden, Jerome A. Zack. (2015) Studium der retroviralen Infektion in humanisierten Mäusen. Virologie479-480. 297-309
CrossRef

Bryan P Burke, Bernard R Levin, Jane Zhang, Anna Sahakyan, Joshua Boyer, Maria V Carroll, Joanna Camba Colón, Naomi Keech, Valerie Rezek, Gregory Bristol, Erica Eggers, Ruth Cortado, Maureen P Boyd, Helen Impey, Saki Shimizu, Emily L Lowe, Gene-Errol E Ringpis, Sohn G Kim, Dimitrios N Vatakis, Louis R Breton, Jeffrey S Bartlett, Irvin SY Chen, Scott G Küche, Dong Sung An, Geoff P Symonds. (2015) Engineering-Cellular Resistenz gegen HIV-1-Infektion in vivo unter Verwendung eines Dual Therapeutic lentiviralen Vektor. Molecular Therapy-Nucleic Acids4. E236
CrossRef

Alessandro F. Fois, Bruce J. Brew. (2015) Das Potential des ZNS als Reservoir für HIV-1-Infektion: Auswirkungen auf die HIV-Eradikation. Aktuelle HIV / AIDS-Berichte
CrossRef

J. Frater. (2015) Dreißig Jahre zur Behandlung von HIV-1-Infektion: wo nächste. Transaktionen der Royal Society of Tropical Medicine und Hygiene109. 229-230
CrossRef

Guan-Han Li, Caroline Anderson, Laura Jaeger, Thao Do, Eugene O. Major, Avindra Nath. (2015) Cell-to-Zell-Kontakt erleichtert HIV-Übertragung von Lymphozyten zu Astrozyten über CXCR4. AIDS29. 755-766
CrossRef

Vanessa L Bryant, Charlotte A Slade. (2015) Chemokine, ihre Rezeptoren und menschliche Krankheit: das gute, das Schlechte und das juckt. Immunologie und Zellbiologie93. 364-371
CrossRef

Chen Xiumin, Yuan Qingting, Liu Zhibin, Yang Jiping, Xu Liran, Guo Huijun. (2015) asymptomatischen Stadium des humanen Immundefizienz-Virus-Infektion ist die optimale Timing für die Verwaltung mit der traditionellen chinesischen Medizin. Journal of Traditional Chinese Medicine35. 244-248
CrossRef

Katherine M. Bruner, Nina N. Hosmane, Robert F. Siliciano. (2015) Auf dem Weg zu einer HIV-1-Heilung: die latente Reservoir zu messen. Trends in der Mikrobiologie23. 192-203
CrossRef

R. P. Walensky, J. D. Auerbach. Amt für AIDS Research Advisory Council, CJ Carpenter, JD Auerbach, M. Agosto-Rosario, D. Averitt, JG Bartlett, JW Curran, RJ DiClemente, W. El-Sadr, A. Haase, S. Hillier, KK Holmes, PA Volberding, RP Walensky. (2015) Fokussierung National Institutes of Health HIV / AIDS-Forschung für maximale Bevölkerung Auswirkungen. Clinical Infectious Diseases60. 937-940
CrossRef

L. T. Vo, G. Q. Daley. (2015) De-novo-Generation von HSCs aus somatischen und pluripotenten Stammzellquellen. Blut
CrossRef

Carmen de Mendoza, Pablo Barreiro, Laura Benitez, Vicente Soriano. (2015) Gene-Therapie für HIV-Infektion. Gutachten über die biologische Therapie15. 319-327
CrossRef

Mary Jane Drake, Paul Bates. (2015) Die Anwendung der Gen-Bearbeitungstechnologien HIV-1. Current Opinion in HIV und AIDS10. 123-127
CrossRef

Matthew H. Porteus. (2015) Genome Bearbeiten des Blutes: Chancen und Herausforderungen. Aktuelle Stem Cell Reports1. 23-30
CrossRef

Kristie Bloom, Claudio Mussolino, Patrick Arbuthnot. (2015) Transkriptionsaktivator-Like-Effektor (TALE) Nukleasen und Repressor tales für antivirale Gentherapie. Aktuelle Stem Cell Reports1. 1-8
CrossRef

Wan-Gang Gu. (2015) Genome Editing-basierten HIV-Therapien. Trends in Biotechnology33. 172-179
CrossRef

David L. DiGiusto. (2015) Cell Gentherapie für HIV Stamm: Strategien das Eindringen des Virus und Replikation zu hemmen. Aktuelle HIV / AIDS-Berichte12. 79-87
CrossRef

Ann Chahroudi, Guido Silvestri, Mathias Lichterfeld. (2015) T-Speicher Stammzellen und HIV: eine langfristige Beziehung. Aktuelle HIV / AIDS-Berichte12. 33-40
CrossRef

Saki Shimizu, Gene-Errol Ringpis, Matthew D Marsden, Ruth V Cortado, Holly M Wilhalme, David Elashoff, Jerome A Zack, Irvin S Y Chen, Dong Sung An. (2015) RNAi-Mediated CCR5 Sturz Bietet HIV-1 Resistenz gegen den Gedächtnis-T-Zellen in Humanized BLT Mäuse. Molecular Therapy-Nucleic Acids4. E227
CrossRef

E. D. A. Owusu, B. J. Visser, I. M. Nagel, P. F. Herren, M. P. Grobusch. (2015) Die Wechselwirkung zwischen Sichelzellenanämie und HIV-Infektion: Eine systematische Übersicht. Clinical Infectious Diseases60. 612-626
CrossRef

V. Madhavi, FE Ana-Sosa-Batiz, S. Jegaskanda, RJ Center, WR Winnall, MS Parsons, J. Ananworanich, DA Cooper, AD Kelleher, D. Hsu, S. Pett, I. Stratov, M. Kramski, SJ Kent. (2015) Antikörper-abhängige Effektorfunktionen gegen HIV Rückgang der Probanden, die antiretrovirale Therapie. Journal of Infectious Diseases211. 529-538
CrossRef

David Benjamin Turitz Cox, Randall Jeffrey Platt, Feng Zhang. (2015) Therapeutische Genome Editing: Perspektiven und Herausforderungen. Nature Medicine21. 121-131
CrossRef

John Thornhill, Sarah Fidler, John Frater. (2015) Weiterentwicklung des HIV-Behandlung Agenda. Current Opinion in Infectious Diseases28. 1-9
CrossRef

Alice Tseng, Jason Seet, Elizabeth J. Phillips. (2015) Die Entwicklung von drei Jahrzehnten antiretrovirale Therapie: Herausforderungen, Erfolge und das Versprechen der Zukunft. British Journal of Clinical Pharmacology79 : 10.1111 / bcp.2015.79.issue-2, 182-194
CrossRef

Leslie R. Cockerham, Hiroyu Hatano. (2015) Elite Kontrolle von HIV: ist dies das richtige Modell für eine funktionelle Heilung. Trends in der Mikrobiologie23. 71-75
CrossRef

A. Bamford, H. Lyall. (2015) Pädiatrische HIV aufwächst: jüngsten Fortschritte in der perinatalen HIV erworben. Archives of Disease in Childhood100. 183-188
CrossRef

Fowzan S. Alkuraya. (2015) Menschen Knockout Forschung: neue Horizonte und Chancen. Trends in Genetics31. 108-115
CrossRef

Jintanat Ananworanich, Brian McSteen, Merlin L. Robb. (2015) breit neutralisierenden Antikörper und dem HIV Reservoir in akuter HIV-Infektion. Current Opinion in HIV und AIDS. 1
CrossRef

Barna Dey, Edward A. Berger. (2015) zu einer HIV-Behandlung basiert auf gezielte Tötung von infizierten Zellen. Current Opinion in HIV und AIDS. 1
CrossRef

John B. Schell, Kapil Bahl, Ewa Folta-Stogniew, Nina Rose, Linda Buonocore, Preston A. Marx, Ratish Gambhira, John K. Rose. (2015) Antigenic Voraussetzung für Gag in einem Impfstoff, der hochdosierten Schleimhaut Herausforderung schützt vor mit Simian Immunodeficiency Virus. Virologie476. 405-412
CrossRef

Elena Herrera-Carrillo, Ben Berkhout. (2015) Mögliche Mechanismen für die zellbasierte Gentherapie von HIV / AIDS zu behandeln. Expert Opinion on Therapeutic Targets19. 245-263
CrossRef

Lisa Scherer, John Burnett, John Rossi. RNA-Interferenz-basierten Gentherapie-Strategien für die Behandlung von HIV-Infektion. 2015 1033-1044.
CrossRef

Mei Mei, Jianqiang Ye, Aijian Qin Lin Wang, Xuming Hu, Kun Qian, Hongxia Shao. (2015) Identifizierung neuer Virus-Rezeptoren mit Zelllinie, die virale Rezeptor-bindendes Protein. Wissenschaftliche Berichte5. 7935
CrossRef

S. T. Smiley, A. Singh, S. W. Read, O. K. Sharma, D. Finzi, C. Lane, J. S. Rice. (2015) Fortschritte bei der Härtung von HIV-Infektionen mit der Transplantation hämatopoetischer Stammzellen. Clinical Infectious Diseases60. 292-297
CrossRef

Kaitlin Regenwasser-Lovett, Katherine Luzuriaga, Deborah Persaud. (2015) Sehr frühe Kombination antiretroviralen Therapie bei Säuglingen. Current Opinion in HIV und AIDS10. 11.04
CrossRef

Bernard J. C. Macatangay, Charles R. Rinaldo. (2015) Die Erhaltung HIV-spezifischen T-Zell-Reaktionen. Current Opinion in HIV und AIDS10. 55-60
CrossRef

Douglas F. Nixon, Gary L. Simon, Rui André Saraiva Raposo. (2015) Test, zu behandeln und zu heilen. JAIDS Journal of Acquired Immune Deficiency Syndromes68. e9-e10
CrossRef

Rowena E. Johnston, Mary M. Heitzeg. (2015) Geschlecht, Alter, Rasse und Interventionsform in klinischen Studien von HIV Cure: A Systematic Review. AIDS-Forschung und Human Retroviruses31. 85-97
CrossRef

Carissa E. Chu, Feng Wu, Xi He, Qingyan Ma, Yu Cheng, Weiping Cai, Paul Volberding, Joseph D. Tucker. (2015) Überlegungen für die soziale Bedeutung der Härtung HIV: Eine qualitative Studie von Menschen, die Drogen in Guangzhou, China injizieren. AIDS-Forschung und Human Retroviruses31. 78-84
CrossRef

Gautam K. Sahu. (2015) Mögliche Verwicklung von Rest Virämie bei Patienten auf effektive antiretrovirale Therapie. AIDS-Forschung und Human Retroviruses31. 25-35
CrossRef

Stefania Zanussi, Maria Teresa Bortolin, Chiara Pratesi, Rosamaria Tedeschi, Giancarlo Basaglia, Luciano Abbruzzese, Mario Mazzucato, Michele Spina, Emanuela Vaccher, Umberto Tirelli, Maurizio Rupolo, Mariagrazia Michieli, Michele Di Mascio, Paolo De Paoli. (2015) Autograft-HIV-DNA-Beschickung Predicts HIV-1 Peripheral Reservoir nach Stammzelltransplantation für AIDS-Lymphom-Patienten. AIDS-Forschung und Human Retroviruses31. 150-159
CrossRef

Abdolreza Esmaeilzadeh, Alieh Farshbaf, Maryam Erfanmanesh. (2015) autologe hämatopoetische Stammzellen-Transplantation und genetische Veränderung von CCR5 M303 / M303 mutierten Patienten für HIV / AIDS. Medical Hypotheses
CrossRef

C. H. Juni S. R. Riddell, T. N. Schumacher. (2015) Adoptive Zelltherapie: Ein Rennen bis zur Ziellinie. Science Translational Medicine7 : 280, 280ps7
CrossRef

Patrick Arbuthnot. Gentherapie für die HIV-1-Infektion. 2015 227-279.
CrossRef

Ciara Staunton. (2015) Die Einwilligungserklärung für HIV Heilung Forschung in Südafrika: Fragen zu prüfen. BMC Medical Ethics16. 3
CrossRef

Alice M. Clomegah, Stephen J. Chapman. (2015) Resistenz gegen zelluläre HIV-Infektion: 1. Entwicklung, Medizin und Public Health2015. 204-204
CrossRef

Jielin Zhang, Clyde Crumpacker. (2015) hämatopoetische Stamm- und Immunzellen bei chronischen HIV-Infektion. Stem Cells International2015. 1-7
CrossRef

(2014) Mehr auf Verschiebung der HIV-Tropismus in Stammzelltransplantation mit CCR5 Delta32 / Delta32 Mutation. New England Journal of Medicine371 25, 2437-2438
Kostenlose Volltext

Stephen A. Spector, Grant R. Campbell. Stetige Autophagie zu Human Immunodeficiency Virus Typ-1-Cure. 2014 127-142.
CrossRef

CrossRef

P. Colson, I. Ravaux, C. Tamalet, O. Glazunova, E. Baptiste, E. Chabrière, A. Wiedemann, C. Lacabaratz, M. Chefrour, C. Picard, A. Stein, Y. Levy, D. Raoult. (2014) HIV-Infektion auf dem Weg nach Endogenisierung: zwei Fälle. Klinische Mikrobiologie und Infektions20. 1280-1288
CrossRef

Sharlie L. Barclay, Yimin Yang, Siruo Zhang, Ryan Fong, Alfonso Barraza, Jan A. Nolta, Bruce E. Torbett, Mehrdad Abedi, Gerhard Bauer, Joseph S. Anderson. (2014) Die Sicherheit und Wirksamkeit einer tCD25 vorge selektive Kombination anti-HIV lentiviralen Vektor in humanen hämatopoetischen Stamm- und Vorläuferzellen. STAMMZELLEN. n / a-n / a
CrossRef

Guang Lan Zhang, Derin B. Keskin, Hsin-Nan Lin, Hong Huang Lin, David S. DeLuca, Scott Leppanen, Edgar L. Milford, Ellis L. Reinherz, Vladimir Brusic. (2014) Human-Leukozyten-Antigen Tippen einer Knowledge Base Gekoppelt mit einem Hochdurchsatz-Oligonukleotidsonde Array-Analyse. Frontiers in Immunology5
CrossRef

Gautam K. Sahu. (2014) Mögliche Verwicklung von Rest Virämie bei Patienten auf effektive ART. AIDS-Forschung und Human Retroviruses. 141126192745002
CrossRef

Jintanat Ananworanich, Merlin L Robb. (2014) Die vorübergehende HIV Vergebung im Baby Mississippi: warum dies eine gute Nachricht ist. Journal der International AIDS Society17
CrossRef

Jonathan Z. Li, Rajesh T. Gandhi. (2014) Die früher, desto besser: mehr Beweise, dass eine frühe antiretrovirale Therapie Blumen Viral Reservoire bei HIV-infizierten Säuglinge. Journal of Infectious Diseases210. 1519-1522
CrossRef

Riya R. Kanherkar, Naina Bhatia-Dey, Evgeny Makarev, Antonei B. Csoka. (2014) Cellular Neuprogrammierung für das Verständnis und der Behandlung menschlicher Erkrankungen. Frontiers in Zell- und Entwicklungsbiologie2
CrossRef

Xin Shi, Matthew D Sims, Michel M Hanna, Ming Xie, Peter G Gulick, Yong-Hui Zheng, Marc D Basson, Ping Zhang. (2014) Neutropenie bei HIV-Infektion: Unerwünschte Konsequenzen und Abhilfen. Internationale Bewertungen für Immunologie33. 511-536
CrossRef

Lachlan R. Grau, Michael Roche, Jacqueline K. Flynn, Steve L. Wesselingh, Paul R. Gorry, Melissa J. Churchill. (2014) ist das zentrale Nervensystem ein Reservoir von HIV-1. Current Opinion in HIV und AIDS9. 552-558
CrossRef

Mohamed Abou-El-Enein, Gerhard Bauer, Petra Reinke, Matthias Renner, Christian K. Schneider. (2014) Ein Fahrplan in Richtung klinische Umsetzung von genetisch veränderten Stammzellen für die Behandlung von HIV. Trends in Molecular Medicine20. 632-642
CrossRef

Regenerative Medizin9. 705-707
CrossRef

Miguel Calero-Garcia, H. Bobby Gaspar. (2014) Gene-ectomy: Gene Ablation mit CRISPR / Cas9 in humanen hämatopoetischen Zellen. Cell Stem Cell15. 529-530
CrossRef

Pankaj K. Mandal, Leonardo MR Ferreira, Ryan Collins, Torsten B. Meissner, Christian L. Boutwells, Max Friesen, Vladimir Vrbanac, Brian S. Garrison, Alexei Stortchevoi, David Bryder, Kiran Musunuru, Harrison Brand, Andrew M. Tager, Todd M. Allen, Michael E. Talkowski, Derrick J. Rossi, Chad A. Cowan. (2014) Effiziente Abtragung von Genen in humanen hämatopoetischen Stamm- und Zellen Effektor mit CRISPR / Cas9. Cell Stem Cell15. 643-652
CrossRef

Jun Hu, Yi Li, Lin Chen, Zhengrong Yang, Guanglu Zhao, Yushu Wang, Jinquan Cheng, Jin Zhao, Ying Peng. (2014) Auswirkungen von IL-22-Gen-Polymorphismus auf eine HIV-Infektion in Han-Chinesen. Journal of Mikrobiologie, Immunologie und Infektions
CrossRef

Leslie R Cockerham, Steven G Deeks. (2014) von Biomarkern enthüllt versteckte Reservoir HIV. eLife3
CrossRef

Angelo Lombardo, Luigi Naldini. (2014) Genome Schnitt: Ein Werkzeug für die Forschung und Therapie: Gezielte Genome Editing trifft die Klinik. Nature Medicine20. 1101-1103
CrossRef

Nadia T Sebastian, Kathleen L Collins. (2014) Targeting HIV Latenz: resting Gedächtnis-T-Zellen, hämatopoetische Vorläuferzellen und zukünftige Richtungen. Experten-Review von Anti-infektiösem Therapie12. 1187-1201
CrossRef

Alison L. Hill, Daniel I. S. Rosenbloom, Feng Fu, Martin A. Nowak, Robert F. Siliciano. (2014), die Ergebnisse der Behandlung Vorhersage des latenten Reservoir für HIV-1 zu beseitigen. Proceedings of the National Academy of Sciences111. 13.475-13.480
CrossRef

G. Le Moal, T. Prazuck, M. Saberan-Roncato, J. Julien, T. Pasdeloup, J.-M. Descamps, M. Lestelle, P. Arsac, E. Champeaux-orange, L. Bouaraba, L. Hocqueloux. (2014) Immuno-virologischen und klinischen Auswirkungen von Krebs bei der Behandlung von Patienten mit HIV. Journal of Antimicrobial Chemotherapy
CrossRef

Sophie Herbert, Emily Chung, Laura Waters. (2014) HIV-Behandlung. Aktuelle Behandlungsmöglichkeiten in Infectious Diseases6. 271-293
CrossRef

Ignacio A. Echenique, George E. Nelson, Valentina Stosor, Christine M. Durand. (2014) HIV und Stammzelltransplantation. Aktuelle Infectious Disease Berichte16
CrossRef

Joel N. Blankson, Janet D. Siliciano, Robert F. Siliciano. (2014) Die Suche nach einer Heilung für Human Immunodeficiency Virus-1-Infektion. Infectious Disease Clinics of North America
CrossRef

Jennifer H. Campbell, Anna C. Hearps, Genevieve E. Martin, Kenneth C. Williams, Suzanne M. Crowe. (2014) Die Bedeutung von Monozyten und Makrophagen in der HIV-Pathogenese, Behandlung und Heilung. AIDS28. 2175-2187
CrossRef

J. D. Siliciano, R. F. Siliciano. (2014) Rekindled HIV-Infektion. Wissenschaft345. 1005-1006
CrossRef

Kordelas. Lambros. Verheyen. Jens. Esser. Stefan. (2014) Verschieben von HIV Tropism in Stammzelltransplantation mit CCR5 Delta32 Mutation. New England Journal of Medicine371 : 9, 880-882
Kostenlose Volltext

J. Symons, L. Vandekerckhove, G. Hutter, A. M. J. Wensing, P. M. van Ham, S. G. Deeks, M. Nijhuis. (2014) Die Abhängigkeit von den CCR5-Korezeptor für die virale Replikation erklärt den Mangel an Rückprall von CXCR4-Prognostizierte HIV-Varianten in der Patienten Berlin. Clinical Infectious Diseases59. 596-600
CrossRef

Nicolas Petit, Karim Dorgham, Béatrice Levacher, Aude Burlion, Guy Gorochov, Gilles Marodon. (2014) Targeting Sowohl virale als auch Host-Determinanten von Human Immunodeficiency Virus Eintrag, Mit einem neuen Lentivirale Vector Koexpression des T20 Fusion Inhibitor und eine selektive CCL5 Intrakine. Human Gene Therapy Methods25. 232-240
CrossRef

Sarah C Sasson, Anthony D Kelleher. (2014) Die ortsspezifische Host-Genveränderung durch Zink-Finger-Nukleasen: indem sie den Weg zu drogenfreie Kontrolle von HIV-1. klinisch & Translationale Immunologie3. e19
CrossRef

D. H. Barouch, S. G. Deeks. (2014) Immunologische Strategien für HIV-1 Vergebung und Tilgung. Wissenschaft345. 169-174
CrossRef

R. Badia, E. Riveira-Munoz, B. Clotet, J. A. Este, E. Ballana. (2014) Gene Bearbeitung einer Zink-Finger-Nuklease mit der CCR5-32-Mutation imitiert induziert Resistenz gegen CCR5-mit HIV-1. Journal of Antimicrobial Chemotherapy69. 1755-1759
CrossRef

Gary Maartens, Connie Celum, Sharon R Lewin. (2014) HIV-Infektion: Epidemiologie, Pathogenese, Behandlung und Prävention. Die Lanzette384. 258-271
CrossRef

Enrique Armijo, Claudio Soto, Brian R. Davis. (2014) HIV / AIDS: Stammzellen im Rampenlicht modifiziert. Cellular and Molecular Life Sciences71. 2641-2649
CrossRef

Catherine N. Kibirige, Frederick A. Menendez, Hao Zhang, Tricia L. Nilles, Susan Langan, Joseph B. Margolick. (2014) Später auftretende HIV-Stämme induziert T-Zell-Homöostase Versagen von Bystander Zelltod und Immun Erschöpfung in naiven CD4 und CD8 alle T-Zellen zu fördern. Medical Hypotheses83. 69-73
CrossRef

Janet D. Siliciano, Robert F. Siliciano. (2014) Die jüngsten Entwicklungen bei der Suche nach einem Heilmittel für HIV-1-Infektion: Targeting das latente Reservoir für HIV-1. Journal of Allergy and Clinical Immunology134. 12-19
CrossRef

William T. Shearer. (2014) Heilung der HIV-Infektion: Ist das lange warten auf. Journal of Allergy and Clinical Immunology134. 20-22
CrossRef

Lin Ye, Jiaming Wang, Ashley I. Beyer, Fernando Teque, Thomas J. Cradick, Zhongxia Qi, Judy C. Chang, Gang Bao, Marcus O. Muench, Jingwei Yu, Jay A. Levy, Yuet Wai Kan. (2014) Nahtlose Änderung von Wildtyp-pluripotenten Stammzellen zur natürlichen CCR5Δ32 Mutation induzierte Resistenz gegen HIV-Infektion. Proceedings of the National Academy of Sciences111. 9591-9596
CrossRef

Matthew Pace, John Frater. (2014) Eine Heilung für HIV: ist es nicht in Sicht. Experten-Review von Anti-infektiösem Therapie12. 783-791
CrossRef

W.-G. Gu, X.-Q. Chen. (2014) Targeting CCR5 für anti-HIV-Forschung. European Journal of Clinical Microbiology & Infektionskrankheiten
CrossRef

Naoki Saito, Hideto Chono, Hiroaki Shibata, Naohide Ageyama, Yasuhiro Yasutomi, Junichi Mineno. (2014) CD4 + T-modifizierten Zellen durch die Endoribonuclease MazF sind sicher und in SHIV-infizierten Rhesus-Makaken persistieren. Molecular Therapy-Nucleic Acids3. E168
CrossRef

Brigitte Autran, Chiraz Hamimi, Christine Katlama. (2014) Einen Schritt näher zu HIV-Eradikation. Aktuelle Behandlungsmöglichkeiten in Infectious Diseases6. 171-182
CrossRef

T. J. Henrich, P. J. McLaren, S. S. S. Rao, N. H. Lin, E. Hanhauser, F. Giguel, R. M. Gulick, H. Ribaudo, P. I. W. de Bakker, D. R. Kuritzkes. (2014) genomweite Assoziationsstudie von Human Immunodeficiency Virus (HIV) -1 Korezeptor Verwendung bei Behandlungs-unerfahrenen Patienten, die an einem AIDS Clinical Trials Group Study. Open Forum Infectious Diseases1. ofu018-ofu018
CrossRef

J. K. Baillie. (2014), durch die Immunantwort des Wirts, Infektionen zu bekämpfen. Wissenschaft344 : 6186, 807-808
CrossRef

Ye Liu, Jieqiong Zhou Ji-An Pan, Prudence Mabiala, Deyin Guo. (2014) Ein neuer Ansatz zu blockieren HIV-1 Korezeptor CXCR4 in Nicht-toxische Manner. Molekulare Biotechnologie
CrossRef

P. D. Burbelo, A. Bayat, C. S. Rhodes, R. Hoh, J. N. Martin, R. Fromentin, N. Chomont, G. Hutter, J. A. Kovacs, S. G. Deeks. (2014) HIV-Antikörper-Charakterisierung als Methode Reservoir Größe Quantifizieren Während kurative Interventionen. Journal of Infectious Diseases209. 1613-1617
CrossRef

Y.-C. Ho, G. M. Laird, R. F. Siliciano. (2014) Mess Umkehrung der HIV-1-Latenz ex vivo Zellen, die aus infizierten Individuen verwendet wird. Proceedings of the National Academy of Sciences111. 6860-6861
CrossRef

Nadia Chanzu, Beatrice Ondondo. (2014) Die Induktion von Potent und langlebiges Antikörper und zelluläre Immunreaktionen im Genitorectal Mucosae Könnte die kritische Determinante der HIV-Impfstoff-Wirksamkeit sein. Frontiers in Immunology5
CrossRef

Robert F Siliciano. (2014) Eröffnung Fronten in der HIV-Impfstoff-Entwicklung: Stauseen Targeting und Heilung zu löschen. Nature Medicine20. 480-481
CrossRef

P. G. Lager, B. Barin, H. Hatano, R. L. Rogers, M. E. Roland, T.-H. Lee, M. Busch, S. G. Deeks. (2014) Reduktion der HIV-Persistenz nach der Transplantation bei HIV-infizierten Nieren-Transplantation Empfänger. American Journal of Transplantation14 : 10.1111 / ajt.v14.5, 1136-1141
CrossRef

Subhra Priyadarshini. (2014) Die Kriminalisierung von Homosexuell Barriere gegen HIV Antwort: Lewin. Natur Indien
CrossRef

Zhenya Ni, David A. Knorr, Laura Bendzick, Jeremy Allred, Dan S. Kaufman. (2014) Die Expression von chimären Rezeptors CD4ζ von natürlichen Killerzellen aus humanen pluripotenten Stammzellen verbessert In-vitro-Aktivität, aber erhöht nicht Unterdrückung der HIV-Infektion in vivo. STAMMZELLEN32 : 10.1002 / stem.v32.4, 1021-1031
CrossRef

Isabel Fofana, Nikolaus Jilg, Raymond T. Chung, Thomas F. Baumert. (2014) Entry-Inhibitoren und zukünftige Behandlung von Hepatitis C. Antiviral Research104. 136-142
CrossRef

Angela Battistini, Marco Sgarbanti. (2014) HIV-1-Latenz: Ein Update von Molekulare Mechanismen und therapeutische Strategien. Viren6. 1715-1758
CrossRef

David M. Margolis. (2014) Persistent HIV-Infektion bei Neugeborenen. AIDS28. 1069-1070
CrossRef

Caroline P. Passaes, Asier Sáez-Cirion. (2014) HIV Heilung Forschung: Fortschritte und Perspektiven. Virologie454-455. 340-352
CrossRef

Marcela V. Maus, Joseph A. Fraietta, Bruce L. Levine, Michael Kalos, Yangbing Zhao, Carl H. Juni. (2014) Adoptive Immuntherapie bei Krebs oder Viren. Annual Review of Immunology32 : 1, 189-225
CrossRef

Tebas. Pablo. Stein. David. Seetang. Winson W. Frank. Ian. Wang. Shelley Q. Lee. Gary. Spratt. S. Kaye. Surosky. Richard T. Giedlin. Martin A. Nichol. Geoff. Holmes. Michael C. Gregory. Philip D. Ando. Dale G. Kalos. Michael. Collman. Ronald G. Binder-Scholl. Gwendolyn. Plesa. Gabriela. Hwang. Wei-Ting. Levine. Bruce L. Juni. Carl H. (2014) Gene Bearbeitung von CCR5 in autologe CD4-T-Zellen von Menschen mit HIV infiziert. New England Journal of Medicine370 : 10, 901-910
Kostenlose Volltext

Nicole H. Tobin Grace M. Aldrovandi. (2014) Kleinkinder sind einzigartig in ihrer Fähigkeit, «Funktionell geheilt» von HIV-1 zu werden. Aktuelle HIV / AIDS-Berichte11. 1-10
CrossRef

A. Schneider, A. Wagner, E. E. Davydova, A. S. Smirnov, I. N. Glazkov, M. M. Shegai, D. V. Glazkova. (2014) Probleme und Perspektiven der Gentherapie gegen HIV. Pharmazeutische Chemie Journal47. 627-635
CrossRef

Rodica Stan, John A. Zaia. (2014) Praktische Überlegungen in der Gentherapie für HIV Cure. Aktuelle HIV / AIDS-Berichte11. 11-19
CrossRef

Chuka Didigu, Robert Doms. (2014) Gene Therapy Targeting HIV Eintrag. Viren6. 1395-1409
CrossRef

Ephraim J. Fuchs. (2014) Transplantationstoleranz: von der Theorie zur Klinik. Immunological Reviews258 : 10.1111 / imr.2014.258.issue-1, 64-79
CrossRef

Marina Cavazzana. (2014) Blutstammzell-Gentherapie: Fortschritte bei der klinischen Front. Human Gene Therapy25. 165-170
CrossRef

Stephanie Shiau, Louise Kuhn. (2014) antiretrovirale Behandlung bei HIV-infizierten Säuglinge und Kleinkinder: Roman Probleme durch das Baby Mississippi angehoben. Experten-Review von Anti-infektiösem Therapie12. 307-318
CrossRef

International Journal of Cardiology
CrossRef

Orit Wolstein, Maureen Boyd, Michelle Millington, Helen Impey, Joshua Boyer, Annett Howe, Frederic Delebecque, Kenneth Cornetta, Michael Rothe, Christopher Baum, Tamara Nicolson, Rachel Koldej, Jane Zhang, Naomi Keech, Joanna Camba Colón, Louis Breton, Jeffrey Bartlett, Dong Sung An, Irvin SY Chen, Bryan Burke, Geoff P Symonds. (2014) Präklinische Sicherheit und Wirksamkeit eines anti-HIV-1 lentiviralen Vektor, der eine short hairpin RNA an CCR5 und die C46-Fusionsinhibitor. Molecular Therapy — Methoden & Klinische Entwicklung1. 11
CrossRef

Ein Falkenhagen, M Ameli, S Asad, S E Read, S Joshi. (2014) Eine neuartige Gentherapie Strategie sezerniert multifunktionales Anti-HIV-Proteine ​​Schutz zu Gen-modifizierten und unmodifizierten Zielzellen zu verleihen. Gentherapie21. 175-187
CrossRef

AIDS28. 543-547
CrossRef

Patrick Younan, John Kowalski, Hans-Peter Kiem. (2014) Genetisch Transplantation hämatopoetischer Stammzellen für HIV-1-infizierten Patienten Modifiziert: können wir eine Heilung erzielen. Molecular Therapy22. 257-264
CrossRef

C. M. Durand, R. F. Siliciano. (2014) Dual-Zink-Finger-Nukleasen blockieren HIV-Infektion. Blut123. 2-3
CrossRef

Emma Chan, Greg Towers, Waseem Qasim. (2014) Gene Therapy Strategies TRIM Abgeleitet Restriktionsfaktoren gegen HIV-1 zu nutzen. Viren6. 243-263
CrossRef

Viren6. 54-68
CrossRef

Antonella d’Arminio Monforte, Valentina Svicher, Silvia Nozza, Adriano Lazzarin, Giulia Marchetti, Carlo-Federico Perno. (2014) Highlights auf HIV Tilgung im Jahr 2013. AIDS28. 1-7
CrossRef

Ashish Swarup Verma, Iqram Govind Singh, Rubin Bansal, Anchal Singh. HIV und antiretroviralen Medikamente. 2014 155-176.
CrossRef

Minjung Song Young-Hoon Kim, Jin-Soo Kim, Hyongbum Kim. Genomtechnik in menschlichen Zellen. 2014 93-118.
CrossRef

Mathilde Krim, Rowena Johnston. (2014) AIDS: The Final Chapter. AIDS-Forschung und Human Retroviruses30. 5-7
CrossRef

Joseph D. Tucker, Stuart Rennie. (2014) Soziale und ethische Implikationen von HIV Heilung Forschung. AIDS. 1
CrossRef

S.A. Spector. Human Immunodeficiency Virus Typ-1. 2014.
CrossRef

Kurt F. Hauser, Pamela E. Knapp. Wechselwirkungen von HIV und Drogen. 2014 231-313.
CrossRef

Anjie Zhen, Scott Kitchen. (2014) Stammzell-basierte Gentherapie für HIV-Infektion. Viren6. 1-12
CrossRef

World Journal of Cardiovascular Diseases04. 325-340
CrossRef

Joaquim Peraire, Consuelo Viladés, Yolanda M Pacheco, Miguel López-Dupla, Pere Domingo, Mar Gutiérrez, Isaac Rosado, Manuel Leal, Cristóbal Richart, Francesc Vidal. (2014) Die Auswertung der Pharmakogenetik von Immun Erholung bei den behandelten HIV-infizierten Patienten. Expert Opinion on Drug Metabolism & Toxikologie10. 81-101
CrossRef

Gerhard Bauer, Joseph S Anderson. (2013) Zelltransplantation im Zusammenhang mit HIV-Stamm — wie können wir die HIV-Infektion zu heilen. Expert Review of Clinical Immunology. 1-10
CrossRef

Alessandra Noto, Lydie Traut. (2013) Die Entwicklung Combined HIV Vaccine Strategien für eine funktionelle Heilung. Vaccines1. 481-496
CrossRef

H. Frickmann, B. Wulff, U. Loderstaedt, R. M. Hagen, D. Sturm, S. Polywka. (2013) Von IEDs zu AIDS? Der Nachweis von HIV in menschlichen Leichen durch eine schnelle Screening-Tests nach dem Verdacht auf absichtliche Übertragung bei Terroranschlägen. Journal der Royal Army Medical Corps159. 278-282
CrossRef

Patrick Younan, John Kowalski, Hans-Peter Kiem. (2013) Genmanipulation von hämatopoetischen Stammzellen als Therapie für HIV / AIDS. Viren5. 2946-2962
CrossRef

J. A. Zaia, S. J. Forman. (2013) Transplantation bei HIV-infizierten Patienten: ist möglich, zu heilen. Hämatologie2013. 389-393
CrossRef

Michael Bennett, Ramesh Akkina. (2013) Gene Therapy Strategien zur Bekämpfung von HIV / AIDS: Präklinische Modellierung in der humanisierten Mäuse. Viren5. 3119-3141
CrossRef

Fatima Barmania, Marnie Potgieter, Michael S. Pfeffer. (2013) Mutationen im C-C-Chemokin-Rezeptor-Typ 5 (CCR5) in der südafrikanischen Individuen. International Journal of Infectious Diseases17. e1148-e1153
CrossRef

Fatima Barmania, Michael S. Pfeffer. (2013) C-C-Chemokin-Rezeptor Typ fünf (CCR5): Ein Schwellen Ziel für die Kontrolle der HIV-Infektion. angewandt & Translational Genomics2. 16.03
CrossRef

Erica B Schleifman, Nicole Ali McNeer, Andrew Jackson, Jennifer Yamtich, Michael A Brehm, Leonard D Shultz, Dale L Greiner, Priti Kumar, W Mark Saltzman, Peter M Glazer. (2013) Die ortsspezifische Genome Editing in PBMCs mit PLGA-Nanopartikel lieferte PNAs Verleiht HIV-1-Resistenz in der humanisierten Mäuse. Molecular Therapy-Nucleic Acids2. e135
CrossRef

U. Hofer, J. E. Henley, C. M. Exline, O. Mulhern, E. Lopez, P. M. Kanone. (2013) Präklinische Modellierung von CCR5 Knockout in humanen hämatopoetischen Stammzellen von Zink-Finger-Nukleasen Unter Verwendung der humanisierten Mäuse. Journal of Infectious Diseases208. S160-S164
CrossRef

A. M. Tager, M. Pensiero, T. M. Allen. (2013) Die jüngsten Fortschritte in der humanisierten Mäuse: Die Beschleunigung der Entwicklung eines HIV-Impfstoffs. Journal of Infectious Diseases208. S121-S124
CrossRef

Persaud. Deborah. Homosexuell. Hannah. Ziemniak. Carrie. Chen. Ya Hui. Piatak. Michael Jr. Chun. Tae-Wook. Belastung. Matthew. Reicher Mann. Douglas. Luzuriaga. Katherine. (2013) Abwesenheit von nachweisbarer HIV-1-Virämie nach Absetzen der Behandlung in einem Säugling. New England Journal of Medicine369 : 19, 1828-1835
Kostenlose Volltext

Hammer. Scott M. (2013) Baby-Schritte auf dem Weg zu einer HIV-Eradikation. New England Journal of Medicine369 : 19, 1855-1857
Voller Text

David DiGiusto, Rodica Stan, Amrita Krishnan, Haitang Li, John Rossi, John Zaia. (2013) Entwicklung von Blutstammzell-basierte Gentherapie für HIV-1-Infektion: Überlegungen zum Proof of Concept Studien und Übersetzung auf Standard der medizinischen Praxis. Viren5. 2898-2919
CrossRef

Kenneth H Mayer. (2013) Das Nachdenken über ein AIDS-End-Spiel. Die Lanzette382. 1462-1464
CrossRef

(2013) Ein vereinfachtes Verfahren für Human Auswertung CCR5 Genetischen Polymorphismus. Der amerikanische Biologie-Lehrer75. 704-707
CrossRef

Steven G Deeks, Sharon R Lewin, Diane V Havlir. (2013) Das Ende von Aids: HIV-Infektion als eine chronische Krankheit. Die Lanzette382. 1525-1533
CrossRef

Nir Eyal, Daniel R Kuritzkes. (2013) Herausforderungen in der klinischen Studiendesign für HIV-1 Heilung Forschung. Die Lanzette382. 1464-1465
CrossRef

T.-W. Chun, A. S. Fauci. (2013) Viruspersistenz in der HIV-Infektion: Viel bekannt ist, viel zu lernen. Journal of Infectious Diseases208. 1356-1358
CrossRef

Joseph D. Tucker. (2013) Die soziale und politische Kontext der Genesung Syphilis: Kommentar zu Francis (2013). Archives of Sexual Behavior42. 1381-1381
CrossRef

S. Zou, S. Glynn, D. Kuritzkes, M. Shah, N. Cook, N. Berliner. (2013) hämatopoetischer Zelltransplantation und HIV-Behandlung: wo wir sind und was als nächstes. Blut122. 3111-3115
CrossRef

Nature Reviews Microbiology
CrossRef

C. A. Didigu, C. B. Wilen, J. Wang, J. Duong, A. J. Secreto, G. A. Danet-Desnoyers, J. L. Riley, P. D. Gregory, C. H. Juni M. C. Holmes, R. W. Doms. (2013) Simultaneous Zinkfinger-Nuclease Editierung des HIV Corezeptoren CCR5 und CXCR4 schützt CD4 + T-Zellen von HIV-1-Infektion. Blut
CrossRef

Fariba S Younai. (2013) Dreißig Jahre des humanen Immundefizienz-Virus-Epidemie und darüber hinaus. International Journal of Oral Wissenschaft
CrossRef

Pierre Corbeau. RNAi Gentherapie HIV-1-Infektion zu bekämpfen. 2013 26.1.
CrossRef

David Serrano, Pilar Miralles, Pascual Balsalobre, Mi Kwon, Gabriela Rodriguez-Macias, Jorge Gayoso, Javier Anguita, Ismael Buño, Juan Berenguer, José L. Díez-Martín. (2013) Graft-versus-Tumor-Wirkung nach allogener Stammzelltransplantation bei HIV-positiven Patienten mit hohem Risiko malignen hämatologischen Erkrankungen. AIDS-Forschung und Human Retroviruses29. 1340-1345
CrossRef

Janet D Siliciano, Robert F Siliciano. (2013) Die jüngsten Entwicklungen in HIV-1-Arzneimittel-Resistenz. Current Opinion in Virology3 : 5, 487-494
CrossRef

Keith Luckett, Stephen Dummer. Überwachung und das Management von Hepatitis B, Hepatitis C und HIV-Infektion vor und nach der Transplantation. 2013 294-303.
CrossRef

Mireille Centlivre, Nicolas Legrand, Sofieke Klamer, Ying Liu Poi, Karin Jasmijn von Eije, Martino Bohne, Esther Siteur-van Rijnstra, Kees Weijer, Bianca Blom, Carlijn Voermans, Hergen Spits, Ben Berkhout. (2013) präklinische in-vivo-Bewertung der Sicherheit eines Multi-shRNA-basierte Gentherapie gegen HIV-1. Molecular Therapy-Nucleic Acids2. e120
CrossRef

Ester Ballana, José A. Esté. (2013) Erkenntnisse aus der Host-Genomik in der HIV-Infektion und Krankheit: Identifizierung von Host-Ziele für die Arzneimittelentwicklung. Antiviral Research
CrossRef

Ian G. Williams. (2013) Strategien für die Behandlung der HIV-Infektion. Medizin41. 470-473
CrossRef

Anthony R. Cillo, Amrita Krishnan, Ronald T. Mitsuyasu, Deborah K. McMahon, Shirley Li, John J. Rossi, John A. Zaia, John W. Mellors. (2013) Plasmavirämie und Cellular HIV-1 DNA Persist Trotz autologe hämatopoetische Stammzelltransplantation für HIV-Lymphom Stamm. JAIDS Journal of Acquired Immune Deficiency Syndromes63. 438-441
CrossRef

Ben Berkhout. (2013) HIV, Leukämie und neue Horizonte in der molekularen Therapie. Blatt der Formosischer Medical Association112. 441-444
CrossRef

Joseph S Anderson. (2013) Mit TRIM5α als HIV-Therapie: die alpha-Gen. Gutachten über die biologische Therapie13. 1029-1038
CrossRef

T. J. Henrich, R. T. Gandhi. (2013) Frühe Behandlung und HIV-1-Reservoire: Ein Stich in der Zeit. Journal of Infectious Diseases
CrossRef

P. M. Younan, P. Polacino, J. P. Kowalski, C. W. Peterson, N. J. Maurice, N. P. Williams, O. Ho, G. D. Trobridge, D. Von Laer, M. Prlic, B. C. Beard, S. DeRosa, S.-L. Hu, H.-P. Kiem. (2013) Positive Selektion von mC46-exprimierenden CD4 + T-Zellen und die Wartung von Virus-spezifische Immunität in einem Primatenmodell AIDS. Blut122. 179-187
CrossRef

Gregory F. Del Prete, Jeffrey D. Lifson. (2013) Überlegungen bei der Entwicklung von nicht-menschlichen Primatenmodelle von antiretroviralen Kombinationstherapie für die Untersuchung der AIDS-Virus-Unterdrückung, Restvirus und Heilstrategien. Current Opinion in HIV und AIDS8. 262-272
CrossRef

C W Peterson, P Younan, K R Jerome, H-P-Kiem. (2013) Combinatorial Anti-HIV-Gentherapie: einen mehrgleisigen Ansatz über HAART zu erreichen. Gentherapie20. 695-702
CrossRef

A D Badley, A Sainski, F Wightman, S R Lewin. (2013) Änderung Zelltod Wege als Ansatz einer HIV-Infektion zu heilen. Cell Death and Disease4. E718
CrossRef

Guislaine Carcelain, Brigitte Autran. (2013) Immune Eingriffe in HIV-Infektion. Immunological Reviews254. 355-371
CrossRef

Stephen J Kent, Jeanette C Reece, Janka Petravić, Alexey Martyushev, Marit Kramski, Robert De Rose, David Cooper, Anthony D Kelleher, Sean Emery, Paul U Cameron, Sharon R Lewin, Miles P Davenport. (2013) Die Suche nach einem HIV-Behandlung: latente Infektion zu bekämpfen. The Lancet Infectious Diseases13. 614-621
CrossRef

M. Kumi Smith, Sarah E. Rutstein, Kimberly A. Powers, Sarah Fidler, William C. Miller, Joseph J. Eron, Myron S. Cohen. (2013) Die Erkennung und Behandlung von frühen HIV-Infektion. JAIDS Journal of Acquired Immune Deficiency Syndromes63. S187-S199
CrossRef

Janet D. Siliciano, Robert F. Siliciano. (2013) HIV-1-Bekämpfungsstrategien. Current Opinion in HIV und AIDS8. 318-325
CrossRef

Carlos Alonso-Villaverde, Javier A. Menéndez, Jorge Joven. (2013) Metabolic Stress in infizierten Zellen kann ein therapeutisches Ziel für Human Immunodeficiency Virus-Infektion darstellen. Medical Hypotheses81. 125-130
CrossRef

David T. Evans, Guido Silvestri. (2013) Nonhuman Primatenmodelle in der Forschung AIDS. Current Opinion in HIV und AIDS8. 255-261
CrossRef

Matthew D. Marsden, Jerome A. Zack. (2013) HIV / AIDS-Eradikation. Bioorganische & Medicinal Chemistry Letters23 : 14, 4003-4010
CrossRef

Matthew T. Weinstock. (2013) Keystone Symposia Konferenz über Precision Genomtechnik und Synthetische Biologie bringt Spieler aus beiden Disziplinen. ACS Synthetische Biologie2. 296-300
CrossRef

Lijing Li, Ludmila Krymskaya, Jianbin Wang, Jill Henley, Anitha Rao, Lan-Feng Cao, Chy-Anh Tran, Monica Torres-Coronado, Agnes Gardner, Nancy Gonzalez, Kenneth Kim, Pei-Qi Liu, Ursula Hofer, Evan Lopez, Philip D Gregory, Qing Liu, Michael C Holmes, Paula M Kanone, John A Zaia, David L DiGiusto. (2013) Genomic Bearbeiten des HIV-1 Korezeptor CCR5 in Adult hämatopoetische Stamm- und Progenitorzellen mit Zink-Finger-Nukleasen. Molecular Therapy21. 1259-1269
CrossRef

L. C. Swenson, W. W. Y. Dong, T. Mo, J. Demarest, D. Chapman, S. Ellery, J. Heera, H. Valdez, A. F. Y. Poon, P. R. Harrigan. (2013) Die Verwendung von Cellular HIV-DNA virologische Ansprechen auf die Maraviroc zur Vorhersage: Leistung der Population-Based und Deep Sequencing. Clinical Infectious Diseases56. 1659-1666
CrossRef

Sharon R Lewin. (2013) Eine Heilung für HIV: wo wir waren, und wohin wir gehen. Die Lanzette381. 2057-2058
CrossRef

TJ Henrich, Z. Hu, JZ Li, G. Sciaranghella, MP Busch, SM Keating, S. Gallien, NH Lin, FF Giguel, L. Lavoie, VT Ho, P. Armand, RJ Soiffer, M. Sagar, AS LaCasce , DR Kuritzkes. (2013) Long-Term Reduction im peripheren Blut von HIV Typ 1 Reservoire Nach Reduzierte Konditionierung allogene Stammzelltransplantation. Journal of Infectious Diseases207. 1694-1702
CrossRef

V. A. Chereshnev, G. Bocharov, S. Bazhan, B. Bachmetyev, I. Gainova, V. Likhoshvai, J. M. Argilaguet, J. P. Martinez, J. A. Rump, B. Mothe, C. Brander, A. Meyerhans. (2013)-Pathogenese und Behandlung von HIV-Infektion: Die Cellular, das Immunsystem und die neuroendokrine Systeme Perspektive. Internationale Bewertungen für Immunologie32. 282-306
CrossRef

Manel Juan, Edurne Pedrosa, Roger Colobran. Chemokine und Chemokinrezeptoren. 2013.
CrossRef

Michael M. Lederman, Francoise Barre-Sinoussi. (2013) Wer hätte das gedacht. Current Opinion in HIV und AIDS8. 163-164
CrossRef

C M Durand, C Flexner. (2013) HIV Cure: Klopfen an der Tür. Klinische Arzneimittellehre & Therapeutik93. 382-384
CrossRef

Christine Rouzioux, Douglas Richman. (2013) Wie man am besten HIV-Reservoirs messen. Current Opinion in HIV und AIDS8. 170-175
CrossRef

Karl Goodkin, Enrique López, David J. Hardy, W. David Hardy. (2013) Neurocognitive Rückgang der HIV-Infektion. Psychiatric Annals43. 204-211
CrossRef

Aiman ​​A. Haqqani, John C. Tilton. (2013) Entry-Inhibitoren und deren Verwendung bei der Behandlung von HIV-1-Infektion. Antiviral Research98. 158-170
CrossRef

Ossama Allam, Suzanne Samarani, Ali Ahmad. (2013) mesenchymale Stammzellen-Therapie bei HIV-infizierten HAART-behandelten nicht-immunen Responder wieder Immunkompetenz. AIDS27. 1349-1352
CrossRef

C. N. Chan, I. Dietrich, M. J. Hosie, B. J. Willett. (2013) Die jüngsten Entwicklungen in humanen Immundefizienz-Virus-1 Latenz Forschung. Journal of General Virology94. 917-932
CrossRef

Weizao Chen, Tianlei Ying, Dimiter S Dimitrov. (2013) Antikörper-basierte Kandidat Therapeutika gegen HIV-1: Auswirkungen auf die Virenbekämpfung und Impfstoff-Design. Gutachten über die biologische Therapie13. 657-671
CrossRef

Liang Shan, Robert F. Siliciano. (2013) Aus der Reaktivierung einer latenten HIV-1 zur Abspaltung des Latent Reservoir: das Vorhandensein von mehreren Hindernissen zu viralen Eradikation. BioEssays. n / a-n / a
CrossRef

A. Shved. (2013) Das Problem der Nabelschnurblut-Banking. Biopolymere und Zell29 : 10,7124 / bc.29.2, 85-98
CrossRef

Sharon Lam, Catherine Poller. (2013) T-Zell-Therapien für HIV. Immunotherapy5. 407-414
CrossRef

Francis Alonzo, Victor J Torres. (2013) Staphylococcus aureus und CCR5: Enthüllung Gemeinsamkeiten in der Wirt-Pathogen-Interaktionen und mögliche Behandlungsstrategien. Zukünftige Mikrobiologie8. 425-428
CrossRef

Richard A Voit, Moira A McMahon, Sara L Sawyer, Matthew H Porteus. (2013) Erzeugung eines HIV-Resistant T-Zell-Linie durch gezielte «Stacking» von Restriktionsfaktoren. Molecular Therapy21. 786-795
CrossRef

Thomas A. Rasmussen, Martin Tolstrup, Anni Winckelmann, Lars Østergaard, Ole S. Søgaard. (2013) Die Beseitigung der latenten HIV Reservoir durch Reaktivierung Strategien: Advancing zu klinischen Studien. Humanimpfstoffe & Immuntherapien9. 790-799
CrossRef

Fatima Boutimah, Julia J. M. Eekels, Ying Liu Poi, Ben Berkhout. (2013) Die antivirale Strategien kombiniert antiretroviralen Medikamenten mit RNAi-vermittelten Angriff auf HIV-1 und zellulären Co-Faktoren. Antiviral Research98. 121-129
CrossRef

Louise Tomlins, Pirapon Juni Ohata, Anchalee Avihingsanon, Reshmie Ramautarsing, Torsak Bunupuradah, Wasana Prasitseubsai, Nadia Kancheva Landolt, Stephen J Kerr, Chatsuda Auchieng, Thanyawee Puthanakit, Jintanat Ananworanich, Praphan Phanuphak, Kiat Ruxrungtham. (2013) Die 16. Bangkok International Symposium on HIV Medicine. Zukünftige Virologie8. 331-333
CrossRef

Mara Biasin, Mariacristina De Luca, Federica Gnudi, Mario Clerici. (2013), um die genetische Basis der Resistenz gegenüber HIV-Infektion und Krankheitsprogression. Expert Review of Clinical Immunology9. 319-334
CrossRef

Dämmerung A. Maier, Andrea L. Brennan, Shuguang Jiang, Gwendolyn K. Binder-Scholl, Gary Lee, Gabriela Plesa, Zhaohui Zheng, Julio Cotte, Carmine Carpenito, Travis Wood, S. Kaye Spratt, Dale Ando, ​​Philip Gregory, Michael C. Holmes, Elena. E. Perez, James L. Riley, Richard G. Carroll, Carl H. Juni Bruce L. Levine. (2013) Effiziente Klinische Skala Genveränderung über Zinkfingernukleasen-gezielte Zerstörung des HIV-Co-Rezeptor CCR5. Human Gene Therapy. 130306065830001
CrossRef

Aktuelle HIV / AIDS-Berichte10. 33-41
CrossRef

Christine Katlama, Steven G Deeks, Brigitte Autran, Javier Martinez-Picado, Jan van Lunzen, Christine Rouzioux, Michael Miller, Stefano Vella, Joern E Schmitz, Jeffrey Ahlers, Douglas D Richman, Rafick P Sekaly. (2013) Hindernisse für eine Heilung für HIV: Neue Wege zum Ziel und HIV-1-Reservoirs zu beseitigen. Die Lanzette
CrossRef

Christine M. Durand, Richard F. Ambinder. (2013) hämatopoetische Stammzelltransplantation bei HIV-1-infizierten Personen. Current Opinion in der Onkologie25. 180-186
CrossRef

Ann Apolloni, Min-Husan Lin, Haran Sivakumaran, Dongsheng Li, Michael H. R. Kershaw, David Harrich. (2013) Ein Mutant Tat-Protein liefert einen starken Schutz vor HIV-1-Infektion in menschlichen CD4 + T-Zellen. Human Gene Therapy24. 270-282
CrossRef

Allan R. Tenorio, Alan L. Landay. (2013) HIV: So nah und doch so weit. Aktuelle HIV / AIDS-Berichte10. 1-2
CrossRef

Tae-Wook Chun. (2013) Tracking-Replikations-kompetente HIV-Reservoirs in infizierten Personen. Current Opinion in HIV und AIDS8. 111-116
CrossRef

Lawrence D. Petz, Istvan Redei, Yvonne Bryson, Donna Regan, Joanne Kurtzberg, Elizabeth Shpall, Jonathan Gutman, Sergio Querol, Pamela Clark, Richard Tonai, Sarah Santos, Aide Bravo, Stephen Spellman, Loren Gragert, John Rossi, Shirley Li, Haitang Li, David Senitzer, John Zaia, Joseph Rosenthal, Stephen Forman, Robert Chow. (2013) hämatopoetischer Zelltransplantation mit Nabelschnurblut für Heilung von HIV-Infektionen. Biologie von Blut und Knochenmarktransplantation19. 393-397
CrossRef

Bruce J Brew, Lachlan Grau, Sharon Lewin, Melissa Chill. (2013) Ist spezifische HIV Tilgung aus dem Gehirn möglich oder notwendig. Gutachten über die biologische Therapie13. 403-409
CrossRef

Janet Chung, David L DiGiusto, John J Rossi. (2013) Combinatorial RNA-basierten Gentherapie für die Behandlung von HIV / AIDS. Gutachten über die biologische Therapie13. 437-445
CrossRef

Ran Taube, Matija Peterlin. (2013) Lost in Transkription: Molekulare Mechanismen, dass die Kontrolle von HIV Latenz. Viren5. 902-927
CrossRef

R van Rensburg, ich Beyer X-Y Yao, H Wang, O Denisenko, Z-Y Li, D W Russell, D G Miller, P Gregory, M Holmes, K Bomsztyk, A Lieber. (2013) Chromatin Struktur von zwei genomischen Websites für gezielte transgene Integration in induzierte pluripotente Stammzellen und hämatopoetischen Stammzellen. Gentherapie20. 201-214
CrossRef

Frank Buchholz, Joachim Hauber. (2013) Engineered DNA-modifizierende Enzyme: Bestandteile einer künftigen Strategie zur Heilung von HIV / AIDS. Antiviral Research97. 211-217
CrossRef

Yuanxi Kang, Jia Guo, Zhiwei Chen. (2013) Schließen Sie die Tür gegen das humane Immundefizienzvirus. Eiweiß & Zelle4. 86-102
CrossRef

Todd Hawley, Mark Spear, Jia Guo, Yuntao Wu. (2013) Die Hemmung der HIV-Replikation in vitro durch klinische Immunsuppressiva und chemotherapeutischen Mitteln. Zelle & Bioscience3. 22
CrossRef

Zene MATSUDA. (2013) gemeinsame Zusammenarbeit in Infectious Diseases in China, der University of Tokyo. Uirusu63. 37-44
CrossRef

Sarah A. Watters, Petra Mlčochová, Ravindra K. Gupta. (2013) Makrophagen. Current Opinion in Infectious Diseases26 : 6, 561
CrossRef

Barbara C Bachler, Michael Humbert, Samir K Lakhashe, Robert A Rasmussen, Ruth M Ruprecht. (2013) Lebendvirus-Exposition von Impfstoff-geschützten macaques ändert die anti-HIV-1-Antikörper-Repertoire in Abwesenheit von Virämie. Retrovirology10. 63
CrossRef

Stephen J O’Brien, Sher L Hendrickson. (2013) Host-genomische Einflüsse auf die HIV / AIDS. Genome Biology14. 201
CrossRef

Renli Ru, Yongchao Yao, Songlin Yu, Benpeng Yin, Wanwan Xu, Siting Zhao, Li Qin, Xiaoping Chen. (2013) Gezielte Genomtechnik in humanen pluripotenten Stammzellen induziert durch Talens eindringt. Zellregeneration2. 5
CrossRef

K M Barton, B D Burch, N Soriano-Sarabia, D M Margolis. (2013) Perspektiven für die Behandlung von Latent HIV. Klinische Arzneimittellehre & Therapeutik93. 46-56
CrossRef

CCR5-Δ32 Gegen HIV-Infektion durch die Hetero Art der Übertragung in einem polnischen Bevölkerung. AIDS-Forschung und Human Retroviruses29. 54-60
CrossRef

Erik De Clercq. Die Nukleosid-Reverse-Transkriptase-Inhibitoren, Nicht-Nukleosid-Reverse-Transkriptase-Inhibitoren und Protease-Inhibitoren bei der Behandlung von HIV-Infektionen (AIDS). 2013 317-358.
CrossRef

Damian FJ Purcell, Julian H Elliott, Anna-Laura Ross, John Frater. (2013) Auf dem Weg zu einer HIV Cure: Wissenschaft und Debatte von der International AIDS Society 2013 Symposium. Retrovirology10. 134
CrossRef

Iart Luca Shytaj, Andrea Savarino. (2013) Eine Heilung für AIDS: eine Frage des Timings. Retrovirology10. 145
CrossRef

Iart Shytaj, Barbara Chirullo, Wendeline Wagner, Maria G Ferrari, Rossella Sgarbanti, Alessandro Corte, Celia LaBranche, Lucia Lopalco, Anna Palamara, David Montefiori, Mark G Lewis, Enrico Garaci, Andrea Savarino. (2013) Investigational Behandlung Suspension und eine verbesserte zellvermittelten Immunität bei Rebound von drogenfreien Erlass von Simian AIDS gefolgt. Retrovirology10. 71
CrossRef

Fabiola E. Del Carpio-Cano, Raul A. DeLa Cadena, Bassel E. Sawaya. (2013) HIV und Knochen-Krankheit: Eine Perspektive der Rolle von microRNAs in Knochenbiologie auf HIV-Infektion. Journal of Osteoporosis2013. 1-8
CrossRef

Modisa S. Motswaledi, Ishmael Kasvosve, Oluwafemi O. Oguntibeju. (2013) Die Rolle der roten Blutkörperchen bei der Verbesserung oder Prävention von HIV-Infektionen und andere Krankheiten. BioMed Research International2013. 1-7
CrossRef

Stefanos Kalomoiris, Je’Tai Lawson, Rachel X. Chen, Gerhard Bauer, Jan A. Nolta, Joseph S. Anderson. (2012) CD25 Preselective Anti-HIV-Vektoren für die Verbesserung der HIV-Gentherapie. Human Gene Therapy Methods23. 366-375
CrossRef

Chukwuka A. Didigu, Robert W. Doms. (2012) Neue Ansätze HIV Eintritt behindert. Viren4. 309-324
CrossRef

Angela M. Mexas, Erin H. Graf, Matthew J. Pace, Jianqing J. Yu, Emmanouil Papasavvas, Livio Azzoni, Michael P. Busch, Michele Di Mascio, Andrea S. Foulkes, Stephen A. Migueles, Luis J. Montaner, Una O’Doherty. (2012) Die gleichzeitige Maßnahmen der gesamten und integrierte HIV-DNA-Monitor Stauseen und die laufende Replikation in Tilgung Studien. AIDS26. 2295-2306
CrossRef

Christine M. Durand, Joel N. Blankson, Robert F. Siliciano. (2012) Entwicklung von Strategien für die HIV-1-Eradikation. Trends in der Immunologie33. 554-562
CrossRef

Alexey Bersenev, Bruce L Levine. (2012) Die Konvergenz der Gen- und Zelltherapie. Regenerative Medizin7. 50-56
CrossRef

Zabrina L Brumme, Denis R Chopera, Mark A Brockman. (2012) Modulation von HIV-Reservoirs durch die Host-HLA: die Lücke zwischen Impfstoff und Heilung überbrücken. Current Opinion in Virology2. 599-605
CrossRef

John C Burnett, John A Zaia, John J Rossi. (2012) Erstellen von genetischen Resistenz gegen HIV. Current Opinion in Immunology24. 625-632
CrossRef

J. L. Gori, D. Chandrasekaran, J. P. Kowalski, J. E. Adair, B. C. Beard, S. L. D’Souza, H.-P. Kiem. (2012) Effiziente Erzeugung, Reinigung und Expansion von CD34 + hämatopoetischen Vorläuferzellen von nicht-menschlichen Primaten-induzierten pluripotenten Stammzellen. Blut120. e35-e44
CrossRef

J. Pietzsch, H. Gruell, S. Bournazos, B. M. Donovan, F. Klein, R. Diskin, M. S. Seaman, P. J. Bjorkman, J. V. Ravetch, A. Ploss, M. C. Nussenzweig. (2012) ein Mausmodell für HIV-1-Eintrag. Proceedings of the National Academy of Sciences109. 15.859-15.864
CrossRef

Evelyn Eisele, Robert F. Siliciano. (2012) Neufestlegung der Viral Reservoire, die verhindern, dass HIV-1-Eradikation. Immunität37. 377-388
CrossRef

Ming Yan, Min Liang Jing Wen, Yang Liu, Yunfeng Lu, Irvin S. Y. Chen. (2012) Einzel siRNA Nanokapseln für verbesserte RNAi Delivery. Journal of the American Chemical Society134. 13.542-13.545
CrossRef

S Bobadilla, N Sunseri, N R Landau. (2012) effiziente Transduktion von myeloischen Zellen von einem HIV-1-abgeleiteten lentiviralen Vektor, der die Vpx akzessorisches Protein-Pakete. Gentherapie
CrossRef

J. P. Williams, J. Frater. (2012) Das aktuelle Verständnis der HIV-Immunpathologie und Behandlung. qjm105. 725-728
CrossRef

Martin S. Hirsch, Daniel R. Kuritzkes. (2012) Die Zukunft der HIV-Behandlung. JAIDS Journal of Acquired Immune Deficiency Syndromes60. S39-S40
CrossRef

Nature Reviews Immunology12. 607-614
CrossRef

Natur487. 293-294
CrossRef

Ester Ballana, José A Esté. (2012) HIV-1-Infektion und CCR5 Δ 32 Homozygotie. Zukünftige Virologie7. 653-658
CrossRef

Larry Gant. (2012) Die «Berliner Patient,» Prävention und zwei Konferenzen: Social Service Research Antworten. Journal of HIV / AIDS & Sozialdienste11. 193-195
CrossRef

Evan J Anderson, Ram Yogev. (2012) Die Herrlichkeit von Richtlinien und die Dämmerung der Realität: Kontroversen und Herausforderungen in der Prävention und Behandlung von HIV bei Kindern. Experten-Review von Anti-infektiösem Therapie10. 761-774
CrossRef

Matthijs Kox, Monique Stoffels, Sanne P. Smeekens, Nens van Alfen, Marc Gomes, Thijs M. H. Eijsvogels, Maria T. E. Hopman, Johannes G. van der Hoeven, Mihai G. Netea, Peter Pickkers. (2012) Der Einfluss der Konzentration / Meditation auf autonomes Nervensystem-Aktivität und die angeborene Immunantwort. Psychosomatik74. 489-494
CrossRef

Ricky Maung, Kathryn E. Medders, Natalia E. Sejbuk, Maya K. Desai, Rossella Russo, Marcus Kaul. (2012) Genetische Vorprägungen vorschlagen eine entscheidende Rolle für die HIV-Co-Rezeptoren in Modelle von HIV-gp120-induzierten Hirnverletzung. Journal of Neuroimmune Pharmakologie7. 306-318
CrossRef

M. Blot, L. Piroth. (2012) L’Infektion par le VIH en France en 2012 réalité, risques et enjeux d’une polypathologie Chronique. Revue des Maladies Respiratoires29. 785-792
CrossRef

Tae-Wook Chun, Anthony S. Fauci. (2012) HIV-Reservoirs. AIDS26. 1261-1268
CrossRef

Alain Lafeuillade. (2012) Die Beseitigung der HIV-Reservoir. Aktuelle HIV / AIDS-Berichte9. 121-131
CrossRef

E. O. Stenger, H. R. Turnquist, M. Y. Mapara, A. W. Thomson. (2012), dendritische Zellen und Regulation der graft-versus-host-Krankheit und Graft-versus-Leukämie-Aktivität. Blut119. 5088-5103
CrossRef

J. Scholler, T. L. Brady, G. Binder-Scholl, W.-T. Hwang, G. Plesa, K. M. Hege, A. N. Vogel, M. Kalos, J. L. Riley, S. G. Deeks, R. T. Mitsuyasu, W. B. Bernstein, N. E. Aronson, B. L. Levine, F. D. Bushman, C. H. Juni. (2012) Dekade-Long Sicherheit und Funktion der Retroviral-Modified chimären Antigenrezeptoren T-Zellen. Science Translational Medicine4. 132ra53-132ra53
CrossRef

Christof Geldmacher, Richard A. Koup. (2012) Pathogen-spezifischen T-Zell-Depletion und Reaktivierung von opportunistischen Erregern in einer HIV-Infektion. Trends in der Immunologie33. 207-214
CrossRef

Felipe García, Agathe León, Josep M. Gatell, Montserrat Plana, Teresa Gallart. (2012) Therapeutische Impfstoffe gegen HIV-Infektion. Impfstoffe & Immunotherapeutics8. 569-581
CrossRef

Sofie Tierärzte, Janine Kimpel, Andreas Volk, Jan De Rijck, Rik Schrijvers, Bert Verbinnen, Wim Maes, Dorothee von Laer, Zeger Debyser, Rik Gijsbers. (2012) Linsenepithels-derived Growth Factor / p75 Qualifiziert als Ziel für die HIV-Gentherapie in der NSG Maus-Modell. Molecular Therapy20. 908-917
CrossRef

V. Le Douce, A. Janossy, H. Hallay, S. Ali, R. Riclet, O. Rohr, C. Schwartz. (2012) Das Erreichen einer Heilung der HIV-Infektion: Haben wir Gründe haben, optimistisch zu sein. Journal of Antimicrobial Chemotherapy67. 1063-1074
CrossRef

Amanda Clarke, Denise Hsu, Stephen J Kerr, Reshmie Ramautarsing, Pirapon Juni Ohata, Nadia Kancheva Landolt, Anchalee Avihingsanon, Wirach Maek-a-Nantawat, Thanyawee Puthanakit, Torsak Bunupuradah, Wasana Prasitsuebsai, Jintanat Ananworanich, Praphan Phanuphak, Kiat Ruxrungtham. (2012) Die 15. Bangkok International Symposium on HIV Medicine. Zukünftige Virologie7. 341-344
CrossRef

Jos Domen, Kimberly Gandy, Jignesh Dalal. (2012) Emerging verwendet für pädiatrische hämatopoetischen Stammzellen. Pediatric Research71. 411-417
CrossRef

Jinyun Yuan, Jianbin Wang, Karen Crain, Colleen Fearns, Kenneth A Kim, Kevin L Hua, Philip D Gregory, Michael C Holmes, Bruce E Torbett. (2012) Zink-Finger-Nuklease Bearbeiten der Menschen cxcr4 fördert HIV-1-CD4 + T-Zellwiderstand und Anreicherung. Molecular Therapy20. 849-859
CrossRef

José R Blanco, Laura Ochoa-Callejero. (2012) konnte CCR5 ein potenzielles Ziel gegen Infektionen sein. Experten-Review von Anti-infektiösem Therapie10. 411-414
CrossRef

Michael W. Evans, Anthony D. Sung, Ivana Gojo, Michael Tidwell, Jacqueline Greer, Mark Levis, Judith Karp, Maria R. Baer. (2012) Risikobewertung in human immunodeficiency virus-assoziierten akuten myeloischen Leukämie. Leukämie & Lymphom53. 660-664
CrossRef

Manju Pant Pretty Garg, Pankaj Seth. (2012) des zentralen Nervensystems Infektion durch HIV-1: Besondere Betonung auf NeuroAIDS in Indien. Proceedings of the National Academy of Sciences, Indien Abschnitt B: Biological Sciences82. 81-94
CrossRef

I. Celine Hanson, William T. Shearer. (2012) Der Ausschluss einer HIV-Infektion, wenn für schwere kombinierte Immunschwäche und anderen T-Zell-Mängel zu prüfen. Journal of Allergy and Clinical Immunology129. 875-876.e5
CrossRef

Miranda Z. Smith, Fiona Wightman, Sharon R. Lewin. (2012) HIV-Reservoire und Strategien für die Eradikation. Aktuelle HIV / AIDS-Berichte9. 5-15
CrossRef

Felipe García. (2012) «Funktionale Heilung» der HIV-Infektion: die Rolle der Immuntherapie. Immunotherapy4. 245-248
CrossRef

F. Di Nunzio, T. Félix, N. J. Arhel, S. Nisole, P. Charneau, A-S. Beignon. (2012) HIV-abgeleiteten Vektoren für die Therapie und die Impfung gegen HIV. Impfstoff30. 2499-2509
CrossRef

Yongchao Yao, Bayaer Nashun, Tiancheng Zhou, Li Qin, Limei Qin, Siting Zhao, Jianyong Xu, Miguel A. Esteban, Xiaoping Chen. (2012) Erzeugung von CD34 + Zellen von CCR5-Gestörte humanen embryonalen und induzierten pluripotenten Stammzellen. Human Gene Therapy23. 238-242
CrossRef

Hans-Peter Kiem, Keith R. Jerome, Steven G. Deeks, Joseph M. McCune. (2012) hämatopoetische-Stem-Cell-basierte Gentherapie für HIV-Erkrankung. Cell Stem Cell10. 137-147
CrossRef

Nyree Maes, Skye Zeller, Priti Kumar. Neuartigen RNA-Interferenz (RNAi) -basierten Nanomedizin zur Behandlung von Virusinfektionen. 2012 199-239.
CrossRef

Ivona Pandrea, Alan L. Landay. Implikationen für die Therapie. 2012 81-132.
CrossRef

Ma Luo, Paul J. McLaren, Francis A. Plummer. Host Genetik und Resistenz gegen HIV-1-Infektion. 2012 169-209.
CrossRef

CrossRef

Juni Yong Choi Juni Myung Kim. (2012) Updates zur Prävention und Behandlung von AIDS. Journal der koreanischen Medical Association55. 146
CrossRef

CrossRef

Per Johan Klasse, Rogier W. Sanders, Andrea Cerutti, John P. Moore. (2012) Wie kann HIV-Typ-1-Env Immunogenität verbessert werden Antikörper-basierten Impfstoff-Entwicklung zu erleichtern. AIDS-Forschung und Human Retroviruses28. 1-15
CrossRef

Victoria Ein Grün, Patrick Arbuthnot, Marc S Weinberg. (2012) Auswirkungen der anhaltenden RNAi-vermittelte Unterdrückung der zellulären Kofaktor Tat-SF1 auf HIV-1-Replikation in CD4 + T-Zellen. Virology Journal9. 272
CrossRef

Journal der International AIDS Society15. 16
CrossRef

Christine Durand, Richard Ambinder, Joel Blankson, Stephen Forman. (2012) HIV-1 und hämatopoetische Stammzelltransplantation. Biologie von Blut und Knochenmarktransplantation18. S172-S176
CrossRef

Jeremy Luban. (2012) TRIM5 und die Regulation der HIV-1-Infektiosität. Molekularbiologie Internationale2012. 1-6
CrossRef

Melanie Swan. (2011) stetigen Fortschritt von Stammzelltherapien: Bericht der 2011 World Stem Cell Summit, Pasadena, Kalifornien, von 03 bis 05 Oktober. Verjüngungs-Forschung14. 699-704
CrossRef

Priya S. Shah, David V. Schaffer. (2011) Antivirale RNAi: Translating Wissenschaft Auf dem Weg zu Therapieerfolg. Pharmazeutische Forschung28. 2966-2982
CrossRef

J Zhou, J J Rossi. (2011) Aktuelle Fortschritte bei der Entwicklung von RNAi-basierter Therapeutika für HIV-1. Gentherapie18. 1134-1138
CrossRef

John Frater. (2011) Neue Ansätze in der HIV-Eradikation Forschung. Current Opinion in Infectious Diseases24. 593-598
CrossRef

S. Palmer, L. Josefsson, J. M. Coffin. (2011) HIV-Reservoirs und die Möglichkeit einer Heilung der HIV-Infektion. Journal of Internal Medicine270 : 10.1111 / jim.2011.270.issue-6, 550-560
CrossRef

Scott L. Butler, Hernan Valdez, Michael Westby, Manos Perros, Carl H. Juni Jeffrey M. Jacobson, Yves Levy, David A. Cooper, Daniel Douek, Michael M. Lederman, Pablo Tebas. (2011) disease modifying therapeutische Konzepte für HIV in der Ära der hochaktiven antiretroviralen Therapie. JAIDS Journal of Acquired Immune Deficiency Syndromes58. 297-303
CrossRef

Janet Chung, John J Rossi, Ulrike Jung. (2011) Aktuelle Fortschritte und Herausforderungen in der HIV-Gentherapie. Zukünftige Virologie6. 1319-1328
CrossRef

Patrick Arbuthnot. (2011) MicroRNA-like Virostatika. Biochemica et Biophysica Acta (BBA) — Gen-regulatorischen Mechanismen1809. 746-755
CrossRef

Alessandra Bandera, Andrea Gori. (2011) Aufdecken der Stauseen: Untersuchung der HIV-Replikation in T-Zellen verarmten Individuen. Zukünftige Virologie6. 1267-1269
CrossRef

LC Swenson, T. Mo, WWY Dong, X. Zhong, CK Woods, A. Thielen, MA Jensen, DJHF Knapp, D. Chapman, S. Portsmouth, M. Lewis, I. James, J. Heera, H. Valdez , PR Harrigan. (2011) Tief V3-Sequenzierung für HIV Typ 1 Tropism bei Behandlungs-unerfahrenen Patienten: Eine erneute Analyse der MERIT-Studie von Maraviroc. Clinical Infectious Diseases53. 732-742
CrossRef

Ben Berkhout, Rogier W. Sanders. (2011) Molekulare Strategien einen ausbruchsicheren antivirale Therapie zu entwickeln. Antiviral Research92. 14.07
CrossRef

Aarthi Chary, Mark Holodniy. (2011) Interferon-Kombinationstherapie für HIV / Hepatitis-C-Virus-Koinfektion. Immunotherapy3. 1087-1102
CrossRef

G Gonzalez, SS Park, DW Chen, S Armitage, EJ Shpall, RR Behringer. (2011) Identifizierung und Häufigkeit der CCR5Δ32 / Δ32 HIV-resistente Nabelschnurblut-Einheiten aus Houston Bereich Krankenhäuser. HIV Medicine12. 481-486
CrossRef

Journal des Anti-infectieux13. 184-190
CrossRef

Erica B. Schleifman, Ranjit Bindra, Jean Leif, Jacob del Campo, Faye A. Rogers, Pradeep Uchil, Olaf Kutsch, Leonard D. Shultz, Priti Kumar, Dale L. Greiner, Peter M. Glazer. (2011) Gezielte Unterbrechung des CCR5-Gens in humanen hämatopoetischen Stammzellen Angeregt durch Peptid-Nukleinsäuren. Chemie & Biologie18. 1189-1198
CrossRef

Jason F. Okulicz. (2011) Aktuelle Perspektiven in der HIV-Therapeutika. Annals of Allergy, Asthma & Immunologie107. 12-13
CrossRef

Mark G. Lewis, Sandrina DaFonseca, Nicolas Chomont, Anna T. Palamara, Maria Tardugno, Antonello Mai, Matt Collins, Wendeline L. Wagner, Jake Yalley-Ogunro, Jack Gewächshäuser, Barbara Chirullo, Sandro Norelli, Enrico Garaci, Andrea Savarino. (2011) Gold Droge Auranofin schränkt die Virusreservoir im Affen AIDS Modell und induziert Eindämmung der Viruslast folgende ART Suspension. AIDS25. 1347-1356
CrossRef

Bundesgesundheits — Gesundheitsforschung — Gesundheitsschutz54. 822-830
CrossRef

Die Lanzette378. 269-278
CrossRef

Rik Schrijvers, Belete Ayele Desimmie, Zeger Debyser. (2011) Rilpivirin: ein Schritt nach vorn in maßgeschneiderten HIV-Behandlung. Die Lanzette378. 201-203
CrossRef

Anjali Joshi, Himanshu Garg, Sherimay Ablan, Eric O. Freed, Kunio Nagashima, N. Manjunath, Premlata Shankar. (2011) Targeting der HIV-Eintrag, Assemblierung und Freisetzung Wege für Anti-HIV-Gentherapie. Virologie415. 95-106
CrossRef

Jan Lunzen, Boris Fehse, Joachim Hauber. (2011) Gene Therapy Strategien: Können wir HIV auszurotten. Aktuelle HIV / AIDS-Berichte8. 78-84
CrossRef

Alain Lafeuillade. (2011) Mögliche Strategien für eine HIV-Infektion Cure. HIV Clinical Trials12. 121-130
CrossRef

JL Troyer, GW Nelson, JA Lautenberger, L. Chinn, C. McIntosh, RC Johnson, E. Sezgin, B. Kessing, M. Malasky, SL Hendrickson, G. Li, J. Pontius, M. Tang, P. Ein , CA Winkler, S. Limousine mühelos, S. Le Clerc, O. Delaneau, J.-F. Zagury, H. Schuitemaker, D. van Manen, J. H. Bream, E. D. Gomperts, S. Buchbinders, J. J. Goedert, G. D. Kirk, S. J. O’Brien. (2011) genomweite Assoziationsstudie impliziert PARD3B-Based AIDS Beschränkung. Journal of Infectious Diseases203. 1491-1502
CrossRef

(2011) in der Literatur. Clinical Infectious Diseases52. iii-iv
CrossRef

Brigitte Autran, Benjamin Descours, Véronique Avettand-Fenoel, Christine Rouzioux. (2011) Elite-Controller als Modell für funktionelle Heilung. Current Opinion in HIV und AIDS6. 181-187
CrossRef

Yuning Lei, Chi-Lin Lee, Kye-Il Joo, Jonathan Zarzar, Yarong Liu, Bingbing Dai, Victoria Fox, Pin Wang. (2011) Gene Bearbeiten von humanen embryonalen Stammzellen über eine Engineered Baculoviral Vector Tragen Zink-Finger-Nukleasen. Molecular Therapy19. 942-950
CrossRef

L. J. Scherer, J. J. Rossi. (2011) Ex-vivo-Gentherapie für die HIV-1-Behandlung. Human Molecular Genetics20. R100-R107
CrossRef

Xiaohui Wang, Yueyun Wang, Lin Chen, Jin Zhao, Li Liu, Xiumin Gan, Xiangdong Shi, Duoshuang Xie, Shaofa Nie, Jinquan Cheng. (2011) Die Korrelation zwischen HLA-Allele A * 02 / A * 24. HLA-DR-Expression und Resistenz gegen HIV-1-Infektion in chinesischen Populationen. Zukünftige Virologie6. 535-541
CrossRef

Sharon R Lewin, Christine Rouzioux. (2011) HIV-Behandlung und Tilgung: Wie erhalten wir aus dem Labor für die klinischen Studien. AIDS25. 885-897
CrossRef

Biologie von Blut und Knochenmarktransplantation17. 586-587
CrossRef

R. Parker, I. Sereti. (2011) Die Leistung von 1 in der HIV-Therapeutika. Blut117. 2746-2747
CrossRef

K. Allers, G. Hutter, J. Hofmann, C. Loddenkemper, K. Rieger, E. Thiel, T. Schneider. (2011) Der Nachweis für die Heilung der HIV-Infektion durch CCR5 32/32 Stammzelltransplantation. Blut117. 2791-2799
CrossRef

klinisch & Experimentelle Immunologie163 : 10.1111 / cei.2011.163.issue-3, 284-295
CrossRef

Avindra Nath, Janice E Clements. (2011) Eradikation von HIV aus dem Gehirn: Gründe für die Pause. AIDS25. 577-580
CrossRef

Rupert Kaul, Craig R. Cohen, Duncan Chege, Tae J. Yi, Wangari Tharao, Lyle R. McKinnon, Robert Remis, Omu Anzala, Joshua Kimani. (2011) Biologische Faktoren, die regionale und rassische Unterschiede in der HIV-Prävalenz beitragen. American Journal of Reproductive Immunology65 : 10.1111 / aji.2011.65.issue-3, 317-324
CrossRef

Paul R. Gorry, Petronela Ancuta. (2011) Corezeptoren und HIV-1-Pathogenese. Aktuelle HIV / AIDS-Berichte8. 45-53
CrossRef

Amal Kambal, Gaela Mitchell, Whitney Cary, William Gruenloh, Yunjoon Jung, Stefanos Kalomoiris, Catherine Nacey, Jeannine McGee, Matt Lindsey, Brian Fury, Gerhard Bauer, Jan A Nolta, Joseph S Anderson. (2011) Erzeugung von HIV-1-beständig und Funktionelle Makrophagen von hämatopoetischen Stammzellen abgeleiteten induzierten pluripotenten Stammzellen. Molecular Therapy19. 584-593
CrossRef

Scott G. Küche, Saki Shimizu, Dong Sung An. (2011) Stammzell-basierte Anti-HIV-Gentherapie. Virologie411. 260-272
CrossRef

Matthew J. Pace, Luis Agosto, Erin H. Graf, Una O’Doherty. (2011) HIV-Reservoirs und Latenz-Modelle. Virologie411. 344-354
CrossRef

Agnieszka Czechowicz, Irving L. Weissman. (2011) Gereinigtes hämatopoetische Stammzelltransplantation: Die nächste Generation von Blut und Immun Ersatz. Hämatologie / Onkologie Kliniken von Nordamerika25. 75-87
CrossRef

Silvia Sorce, Renier Myburgh, Karl-Heinz Krause. (2011) Der Chemokinrezeptor CCR5 im zentralen Nervensystem. Fortschritte in der Neurobiologie93. 297-311
CrossRef

Julia J. M. Eekels, Dirk Geerts, Rienk E. Jeeninga, Ben Berkhout. (2011) Die langfristige Hemmung der HIV-1-Replikation mit RNA-Interferenz gegen zelluläre Cofaktoren. Antiviral Research89. 43-53
CrossRef

Edward A Berger. (2011) Gezielte zytotoxischen Therapie: eine schnell fortschreitende Anti-Krebs-Paradigma für die Erschöpfung von persistenten HIV-infizierten Zellreservoirs anzupassen. Current Opinion in HIV und AIDS6. 80-85
CrossRef

Nataša Čolović, Vladimir Jurišić, Tatjana Terzić, Djordje Jevtović, Milica Čolović. (2011) Alveolare Granulozytäre Sarkom der Mandibula bei einem Patienten mit HIV. Onkologie34. 55-58
CrossRef

Paula Cannon Carl Juni. (2011) Chemokin-Rezeptor 5-Knockout-Strategien. Current Opinion in HIV und AIDS6. 74-79
CrossRef

Scott G Küche, Jerome A Zack. (2011) Stammzell-basierte Ansätze HIV-Infektion zu behandeln. Current Opinion in HIV und AIDS6. 68-73
CrossRef

AIDS25. 273-274
CrossRef

Ekaterina Pomerantseva, Valeri Kukharenko, Adam Goodman, Oleg Verlinsky, Svetlana Rechitsky, Anver Kuliev. (2011) Menschliche embryonale Stammzelllinien mit CCR5-del32 Allel Resistenz gegen HIV verleihen. Stem Cell Entdeckung01. 67-70
CrossRef

Julia J. M. Eekels, Ben Berkhout. Gegen eine haltbare Behandlung von HIV-1-Infektion RNA-Interferenz. 2011 141-163.
CrossRef

Lina Josefsson, Viktor Dahl, Sarah Palmer. (2010) kann eine HIV-Infektion durch die Verwendung von potenten antiviralen Mitteln ausgerottet. Current Opinion in Infectious Diseases23. 628-632
CrossRef

Inmaculada Moreno-Gimeno, Maria H. Ledran, Majlinda Lako. (2010) hämatopoetische Differenzierung von humanen WSR als Modell für Entwicklungsstudien und zukünftige klinische Übersetzungen. Eingeladen Überprüfung der FEBS Anniversary Prize folgenden eingegangen am 5. Juli 2009 im 34. FEBS-Kongress in Prag. FEBS Journal277. 5014-5025
CrossRef

Jie Wang, Hong-sheng Lin, Meng-yu Liu Yong Li. (2010) immunrekonstitutionellen des erworbenen Immunschwächesyndroms. Chinese Journal of Integrative Medizin16. 557-564
CrossRef

Geoff P. Symonds, Helen A. Johnstone, Michelle L. Millington, Maureen P. Boyd, Bryan P. Burke, Louis R. Breton. (2010) Die Verwendung von zell geliefert Gentherapie für die Behandlung von HIV / AIDS. Immunologische Forschung48. 84-98
CrossRef

William Douglas King, Gail E. Wyatt, Honghu Liu, John K. Williams, Anthony D. DiNardo, Ronald T. Mitsuyasu. (2010) Pilot Beurteilung der HIV-Gentherapie-Blutstammzell-Clinical Trial Acceptability Unter Minorität Patienten und deren Berater. Journal des National Medical Association102 : 12, 1123-1130
CrossRef

Masakazu Kamata, Shirley Liu, Min Liang, Yoshiko Nagaoka, Irvin S. Y. Chen. (2010) Herstellung von humanen induzierten pluripotenten Stammzellen mit einem von Anti-HIV-Transgene von einem lentiviralen Vektor Tragen eines internen Murine Leukemia Virus Promoter. Human Gene Therapy21. 1555-1567
CrossRef

Belinda Lee, Mark Bower, Thomas Newsom-Davis, Mark Nelson. (2010) HIV-bezogenen Lymphoms. HIV-Therapie4. 649-659
CrossRef

Rowena Johnston. (2010) HIV Cure: Kontroverse, Konsens und ein Konsortium. AIDS-Forschung und Human Retroviruses26. 943-946
CrossRef

Amrita Krishnan, Stephen J Forman. (2010) hämatopoetische Stammzelltransplantation bei AIDS-bezogenen Malignitäten. Current Opinion in der Onkologie22. 456-460
CrossRef

Fyodor D. Urnov, Edward J. Rebar, Michael C. Holmes, H. Steve Zhang, Philip D. Gregory. (2010) Genome Bearbeitung mit technisch Zink-Finger-Nukleasen. Nature Reviews Genetics11. 636-646
CrossRef

Nathalia Holt, Jianbin Wang, Kenneth Kim, Geoffrey Friedman, Xingchao Wang, Vanessa Taupin, Homosexuell M Crooks, Donald B Kohn, Philip D Gregory, Michael C Holmes, Paula M Kanone. (2010) humane hämatopoetische Stammzellen / Vorläuferzellen, modifiziert durch Zinkfinger-Nucleasen gezielte CCR5 Steuer HIV-1 in vivo. Nature Biotechnology28. 839-847
CrossRef

David Serrano, Pilar Miralles, Pascual Balsalobre, José Luis Díez-Martin, Juan Berenguer. (2010) Stammzelltransplantation bei Patienten mit HIV infiziert. Aktuelle HIV / AIDS-Berichte7. 175-184
CrossRef

Steven G Deeks, Joseph M McCune. (2010) Kann HIV mit Stammzell-Therapie geheilt werden. Nature Biotechnology28. 807-810
CrossRef

G D Trobridge, H-P-Kiem. (2010) Großtiermodellen von hämatopoetischen Stammzellen Gentherapie. Gentherapie17. 939-948
CrossRef

Leo Luznik, Ephraim J. Fuchs. (2010) Die hochdosierte, post-Transplantation Cyclophosphamid Transplantat-Wirt-Toleranz nach allogener Transplantation hämatopoetischer Stammzellen zu fördern. Immunologische Forschung47. 65-77
CrossRef

Paul A Volberding, Steven G Deeks. (2010) antiretrovirale Therapie und Behandlung der HIV-Infektion. Die Lanzette376. 49-62
CrossRef

Ben Berkhout. (2010) HIV-basierten lentiviralen Vektoren für die anti-HIV-Gentherapie. Zukünftige Virologie5. 367-369
CrossRef

Ayca Gucalp, Ariela Noy. (2010) Spektrum von HIV-Lymphom 2009. Current Opinion in Hematology17. 362-367
CrossRef

Janelle Weaver. (2010) Die Forscher knock down-Gen von HIV in seinen Schienen zu stoppen. Nature Medicine16. 731-731
CrossRef

DL DiGiusto, A. Krishnan, L. Li, H. Li, S. Li, A. Rao, S. Mi, P. Yam, S. Stinson, M. Kalos, J. Alvarnas, SF Lacey, J.-K . Yee, M. Li, L. Couture, D. Hsu, S. J. Forman, J. J. Rossi, J. A. Zaia. (2010) RNA-basierte Gentherapie für HIV mit lentiviralen Vektor-Modified CD34 + Zellen bei Patienten Transplantation für AIDS-Lymphom. Science Translational Medicine2. 36ra43-36ra43
CrossRef

Atze T Das, Rienk E Jeeninga, Ben Berkhout. (2010) Mögliche Anwendungen für die Replikation von HIV-1-Vektoren. HIV-Therapie4. 361-369
CrossRef

Agnieszka Czechowicz, Irving L. Weissman. (2010) Gereinigtes hämatopoetische Stammzelltransplantation: Die nächste Generation von Blut und Immun Ersatz. Immunologie und Allergie-Kliniken von Nordamerika30. 159-171
CrossRef

Larry A. Donoso, Tamara Vrabec, Helena Kuivaniemi. (2010) Die Rolle von Complement Factor H in altersbedingte Makula-Degeneration: A Review. Survey of Ophthalmology55. 227-246
CrossRef

Kara S. Keedy, David M. Margolis. (2010) Therapie für persistente HIV. Trends in Pharmacological Sciences31. 206-211
CrossRef

Y Lai. (2010) Die Annahme autologe hämatopoetische Stammzellen mit nicht-funktionellen CCR5 und CXCR4 gegen HIV. Knochenmarktransplantation45. 770-771
CrossRef

M N Polizzotto, M Skinner, M F Cole-Sinclair, S S Opat, A Spencer, S Avery. (2010) Allo-SCT für hämatologischen Malignitäten bei der Einstellung von HIV. Knochenmarktransplantation45. 584-586
CrossRef

Ping An, Cheryl A. Winkler. (2010) Host-Gene im Zusammenhang mit HIV / AIDS: Fortschritte in der Genforschung. Trends in Genetics26. 119-131
CrossRef

Min Liang, Masakazu Kamata, Kevin N. Chen, Nonia Pariente, Dong Sung An, Irvin S. Y. Chen. (2010) Inhibition of HIV-1-Infektion durch eine einzigartige RNA short hairpin an Chemokinrezeptor 5 geliefert zu Makrophagen durch Transduktion hämatopoetischer Progenitorzellen. Das Journal of Gene Medicine12 : 10.1002 / jgm.v12: 3, 255-265
CrossRef

Nathalie Arhel, Frank Kirchhoff. (2010) Host-Proteine ​​in HIV-Infektion beteiligt: ​​Neue therapeutische Ziele. Biochemica et Biophysica Acta (BBA) — Molekulare Grundlagen der Krankheit1802. 313-321
CrossRef

S. Shimizu, S. Hong, B. Arumugam, L. Pokomo, J. Boyer, N. Koizumi, P. Kittipongdaja, A. Chen, G. Bristol, Z. Galic, JA Zack, O. Yang, ISY Chen, B. Lee, DS ein. (2010) Eine hocheffiziente kurze haarnadel RNA potent herunterreguliert CCR5-Expression in systemischen lymphatischen Organen in der hu-BLT-Mausmodell. Blut115. 1534-1544
CrossRef

Lucia Lopalco. (2010) CCR5: Von natürliche Resistenz gegen eine neue Anti-HIV-Strategie. Viren2. 574-600
CrossRef

Sandesh Subramanya, Sang-Soo Kim, N Manjunath, Premlata Shankar. (2010) RNA-Interferenz-basierter Therapeutika für die menschliche Immunschwäche-Virus HIV-1-Behandlung: synthetische siRNA oder vektorbasierte shRNA. Gutachten über die biologische Therapie10. 201-213
CrossRef

José A. Esté, Tomas Cihlar. (2010) Stand und Herausforderungen der antiretroviralen Forschung und Therapie. Antiviral Research85. 25-33
CrossRef

S. Dhanireddy, R. Harrington. Human Immunodeficiency Virus-Infektion und das Acquired Immunodeficiency Syndrome. 2010 256-286.
CrossRef

Yoko Oka, Haruko Tashiro, Mitsuho Mizutani-Noguchi, Ichiro Koga, Toshihiko Sugao, Ryosuke Shirasaki, Toshiyuki Miura, Nobu Akiyama, Kazuo Kawasugi, Shin Fujimori, Naoki Shirafuji. (2010) Successful nicht verwandten Knochenmarktransplantation für ein menschliches Immunschwächevirus Typ-1-seropositiven akuter myeloischer Leukämie Patienten nach HAART. International Journal of Hematology91. 140-145
CrossRef

John S. Albin, Reuben S. Harris. (2010) Wechselwirkungen von Host APOBEC3 Restriktionsfaktoren mit HIV-1 in vivo: Implikationen für die Therapie. Expertentests in Molecular Medicine12
CrossRef

Zelltherapie12. 107-112
CrossRef

Mohammad Kazemi Arababadi, Gholam Hassanshahi, Hossein Azin, Vajihe Akbarpour Salehabad, Majid Araste, Reza Pourali, Zohre Nekhei. (2010) keine Verbindung zwischen CCR5-Δ32 Mutation und Multiple-Sklerose-Patienten in Südost Iran. Labormedizin41. 31-33
CrossRef

Manel Juan, Roger Colobran. Chemokine und Chemokinrezeptoren. 2009.
CrossRef

Joseph S Anderson, John Javien, Jan A Nolta, Gerhard Bauer. (2009) Preintegration HIV-1-Hemmung durch eine Kombination Lentivirale Vektor enthält eine Chimäre TRIM5α Protein, ein CCR5 shRNA und eine TAR Decoy. Molecular Therapy17. 2103-2114
CrossRef

Friso L. H. Muntinghe, Sascha Gross, Stephan J. L. Bakker, Gijs W. D. Landman, Pim van der Harst, Henk J. G. Bilo, Gerjan Navis, Mike W. Zuurman. (2009) CCR5Δ32 Genotyp mit Ergebnissen bei Typ 2 Diabetes mellitus verbunden sind. Diabetes-Forschung und klinische Praxis86. 140-145
CrossRef

Vincent Soriano, Carlo-Federico Perno, Rolf Kaiser, Vincent Calvez, Jose M Gatell, Giovanni di Perri, Deenan Pillay, Jürgen Rockstroh, Anna Maria Geretti. (2009) Wann und wie Maraviroc zu verwenden, bei HIV-infizierten Patienten. AIDS23. 2377-2385
CrossRef

Joseph S Anderson, Jon Walker, Jan A Nolta, Gerhard Bauer. (2009) Spezifische Transduction von HIV-empfängliche Zellen für CCR5 Sturz und Resistenz gegen HIV-Infektion: eine neuartige Methode zur gezielten Gentherapie und intrazellulärer Immunisierung. JAIDS Journal of Acquired Immune Deficiency Syndromes52. 152-161
CrossRef

Thomas Newsom-Davis, Eliyaz Ahamed, Mark Bower. (2009) Immunotherapy für HIV-assoziierten Non-Hodgkin-Lymphom. Gutachten über die biologische Therapie9. 1313-1324
CrossRef

Ben Berkhout. (2009) zu einer Durable Anti-HIV-Gentherapie auf Basis der RNA-Interferenz. Annalen der New Yorker Akademie der Wissenschaften1175. 14.03
CrossRef

Anastas Pashov, Swetha Garimalla, Behjatolah Monzavi-Karbassi, Thomas Kieber-Emmons. (2009) Carbohydrate Ziele in der Forschung HIV-Impfstoff: Lehren aus Fehlern. Immunotherapy1. 777-794
CrossRef

Manish Sagar. (2009) Klinische Implikationen der neuen Erkenntnisse in der HIV-Grundlagenforschung. HIV-Therapie3. 351-360
CrossRef

Ophélie Marais. (2009) Transplantation de cellules souches et Infektion VIH. Option / Bio20 : 420, 9
CrossRef

(2009) Un Sida guéri par une greffe de moelle. Revue Frankophonie des Laboratoires2009 : 412, 18
CrossRef

Joe Alper. (2009) Einmalige Therapie für HIV. Nature Biotechnology27. 300-300
CrossRef

(2009) Kurz und bündig. Nature Reviews Immunology9. 227-227
CrossRef

(2009) Trial Watch: Neue HIV-Gentherapie tritt Phase I-Studie. Nature Reviews Drug Discovery8. 267-267
CrossRef

(2009) Knochenmarktransplantation Muffeln HIV. Nature Medicine15. 371-371
CrossRef

Erheben. Jay A. (2009) Nicht eine HIV Cure, aber ermutigende New Directions. New England Journal of Medicine360 : 7, 724-725
Voller Text

Heidi Ledford. (2009) Stammzelltransplantation tilgt HIV. Natur
CrossRef

C. A. Speil. (2009) Langzeitkontrolle von HIV durch CCR5 Delta32 / Delta32 Stammzelltransplantation. Jahrbuch der Medizin2009. 124-125
CrossRef

ZUSAMMENHÄNGENDE POSTS

  • Long-Term Ozonexposition und Mortalität …

    Long-Term Ozonexposition und Mortalität Hintergrund Obwohl viele Studien Erhebungen in Ozon in der Troposphäre zu negativen gesundheitlichen Folgen, die Auswirkungen der langfristigen Exposition gegenüber Ozon auf Luft in Verbindung gebracht …

  • Hiv statistics_3

    Editor s Hinweis: Die Erzählung und schließen Titel in diesem Video sind in englischer Sprache. Für Untertitel in 13 anderen Sprachen finden Sie in diesem Video auf der Website der Weltgesundheitsorganisation. Gene Bearbeiten …

  • Lenalidomid Wartung nach …

    Lenalidomid Wartung nach Stammzelltransplantation für Multiple Myeloma Artikel Tätigkeit während der letzten zehn Jahre, Hochdosis-Chemotherapie mit autologer Stammzelltransplantation hat …

  • Long-Term inhalativen Kortikosteroiden …

    Long-Term inhalativen Kortikosteroiden bei Vorschulkindern mit Hohem Risiko für Asthma Methoden Wir Zufällig 285 Teilnehmer Zwei oder drei Jahren, mit Einem positiven Asthma Predictive sterben …

  • Wie Antibabypillen, Ceftriaxon Pillen.

    Birth Control Pills / empfängnisverhütende Pillen Arten, Vorteile Risiken Kommentare zum Thema sein sollte und nicht missbräuchlich sein. Die Redaktion behält sich das Recht zu überprüfen und zu moderieren …

  • NATURAL Geburtenkontrolle — Papaya …

    ccrgdotcom Manche Paare entscheiden, nicht, Kondome zu benutzen, wenn Sie das tun, oder wenn Sie nicht tun, dann ist hier einige Möglichkeiten, nicht schwanger zu werden und nicht IUP oder pharmazeutischen Basis BC Drogen verwenden. Hier sind einige…